ID: 1029675261

View in Genome Browser
Species Human (GRCh38)
Location 7:102064307-102064329
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675261_1029675265 4 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675265 7:102064334-102064356 GCAACGGTGCCGGCTCTAAATGG No data
1029675261_1029675269 18 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675269 7:102064348-102064370 TCTAAATGGTTTTAAGGGCACGG 0: 1
1: 2
2: 1
3: 11
4: 187
1029675261_1029675264 -6 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675261_1029675266 12 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675261_1029675268 13 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675261 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr