ID: 1029675262

View in Genome Browser
Species Human (GRCh38)
Location 7:102064308-102064330
Sequence TGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 960678
Summary {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675262_1029675265 3 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675265 7:102064334-102064356 GCAACGGTGCCGGCTCTAAATGG No data
1029675262_1029675264 -7 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675262_1029675268 12 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675262_1029675266 11 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675262_1029675269 17 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675269 7:102064348-102064370 TCTAAATGGTTTTAAGGGCACGG 0: 1
1: 2
2: 1
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675262 Original CRISPR TGCCTGTAATCCCAGCACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr