ID: 1029675264

View in Genome Browser
Species Human (GRCh38)
Location 7:102064324-102064346
Sequence ACAGGCATGAGCAACGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675255_1029675264 6 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675262_1029675264 -7 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675257_1029675264 3 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675252_1029675264 26 Left 1029675252 7:102064275-102064297 CCTGGGCTCAAGCGACTCTCCCA 0: 14
1: 520
2: 7713
3: 40362
4: 129643
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675261_1029675264 -6 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675254_1029675264 7 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675259_1029675264 -3 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675264 Original CRISPR ACAGGCATGAGCAACGGTGC CGG Intronic
No off target data available for this crispr