ID: 1029675266

View in Genome Browser
Species Human (GRCh38)
Location 7:102064342-102064364
Sequence GCCGGCTCTAAATGGTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 29}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675255_1029675266 24 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675254_1029675266 25 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675257_1029675266 21 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675259_1029675266 15 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675262_1029675266 11 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675261_1029675266 12 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675266 Original CRISPR GCCGGCTCTAAATGGTTTTA AGG Intronic
904153032 1:28458806-28458828 GCCGGCTCAAAATCTTTTAAAGG - Intronic
917302822 1:173595216-173595238 GTCGGCTCTCAATGCTCTTAAGG + Intronic
917726913 1:177837000-177837022 GAAGGCTCTACATGGTATTATGG - Intergenic
1090852926 11:130586008-130586030 GCCTGTTCTAACTGGTTTTGGGG + Intergenic
1096422182 12:51468462-51468484 CCCGGCCAGAAATGGTTTTAAGG - Intronic
1101717544 12:107323667-107323689 GCCAGCTCTAAAGGAGTTTAAGG - Intronic
1104216708 12:126740986-126741008 GGCGGCAATAAATGTTTTTAAGG + Intergenic
1106941166 13:34780820-34780842 GCCAGCTCAAAATGCTTTTGAGG - Intergenic
1112259056 13:97861808-97861830 GCCAGCTCTTAGTGGTTTTCTGG - Intergenic
1113555693 13:111232216-111232238 TCTGTCTCTCAATGGTTTTATGG - Intronic
1115321713 14:32087324-32087346 GTTGGCTCTAACAGGTTTTAAGG - Intronic
1141360262 16:83389008-83389030 GTCGGCTCTGACTGGTTTTAGGG - Intronic
1143051192 17:4127295-4127317 CCCAGCTCTAAATGATCTTAAGG + Intronic
1144184370 17:12782944-12782966 GCCAGGTCCATATGGTTTTATGG - Intergenic
1152692872 17:81728437-81728459 GCCAGCTCTAGCTGGTTTTACGG + Intergenic
1153480065 18:5538728-5538750 GCCAGCTCTAATTGGTGTCATGG - Intronic
1165689789 19:37854654-37854676 GCCGGCTCTTTACGGTTCTACGG + Intergenic
1167450117 19:49562442-49562464 CCTGGCTCTAAATCATTTTAAGG - Intronic
1183104225 22:35604803-35604825 GGCGGCTCTGTATGGTTGTATGG - Intergenic
951050616 3:18089278-18089300 GCAGGTTTTAAAAGGTTTTAAGG - Intronic
951114715 3:18846263-18846285 CCCGGCTTTAAATTGTTTAAGGG - Intergenic
962735614 3:138322760-138322782 GCCTGGTCTAAATGGTTCAAGGG - Intronic
980878897 4:138689443-138689465 GCCTGCTCTAAACGGCTTTTGGG + Intergenic
989574047 5:42972430-42972452 CCCTGCTTTAAATGGTTTAAAGG + Intergenic
992521553 5:77556816-77556838 GCCAGTTCTAAATGGCTTGAGGG + Intronic
1010678665 6:78773479-78773501 ATCTGCACTAAATGGTTTTATGG - Intergenic
1025212080 7:57025587-57025609 CCCGGCCCTAAATGGTTTTAAGG + Intergenic
1025659874 7:63551241-63551263 CCCGGCCCTAAATGGTTTTAAGG - Intergenic
1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG + Intronic
1042865791 8:73355877-73355899 GCTGGTTCAAAATGGTTTTCTGG + Intergenic
1046715993 8:117567870-117567892 GATGGCTCCAAATGGTTATATGG + Intergenic
1052184282 9:25572145-25572167 GCTGACTCCACATGGTTTTAAGG + Intergenic
1199026160 X:142941178-142941200 GCTGACTCAAAATGGTTTTTCGG - Intergenic
1201432948 Y:13923805-13923827 ACTTGCTCTAAATTGTTTTAGGG - Intergenic