ID: 1029675268

View in Genome Browser
Species Human (GRCh38)
Location 7:102064343-102064365
Sequence CCGGCTCTAAATGGTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 2, 2: 0, 3: 6, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675254_1029675268 26 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675262_1029675268 12 Left 1029675262 7:102064308-102064330 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675259_1029675268 16 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675257_1029675268 22 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675255_1029675268 25 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675261_1029675268 13 Left 1029675261 7:102064307-102064329 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675268 Original CRISPR CCGGCTCTAAATGGTTTTAA GGG Intronic
912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG + Intronic
920357010 1:205381208-205381230 CCTGTTCTAAATTGTTTTCATGG + Intergenic
923781798 1:237031548-237031570 AAGCCTCTAAATGGTTGTAAAGG - Intergenic
1062858302 10:790534-790556 CCAGCCCTGAATGGTTTTTAAGG - Intergenic
1063610625 10:7558892-7558914 CCGGTTCTGAGTGGTTTTACTGG - Intergenic
1072263163 10:93701977-93701999 CCTCATCTAAAGGGTTTTAACGG + Intronic
1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG + Intergenic
1075933910 10:126323442-126323464 CAGCCTCCAAATGATTTTAAAGG + Intronic
1078101099 11:8330759-8330781 TCGGCTCTATCTGGTTTTACAGG - Intergenic
1079241341 11:18724216-18724238 CCGGCTGTGAATGGTTGTCATGG + Exonic
1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG + Intronic
1091815410 12:3434178-3434200 CAGTCCCTAAAGGGTTTTAATGG - Intronic
1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG + Intronic
1100757754 12:97770746-97770768 CCGGCTCTCAAAGGATTAAAGGG + Intergenic
1101238937 12:102818756-102818778 CTGACATTAAATGGTTTTAATGG - Intergenic
1102210102 12:111120406-111120428 CCGGCTATTTGTGGTTTTAAGGG - Intronic
1102562871 12:113775102-113775124 ACTGCTCTAAGTGCTTTTAAAGG + Intergenic
1103371938 12:120425777-120425799 CCGGCAGTAAATGGTGTAAATGG + Intergenic
1107187276 13:37538406-37538428 TCAGCTCTAAAATGTTTTAATGG - Intergenic
1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG + Intronic
1113555692 13:111232215-111232237 CTGTCTCTCAATGGTTTTATGGG - Intronic
1115321712 14:32087323-32087345 TTGGCTCTAACAGGTTTTAAGGG - Intronic
1121788744 14:96682788-96682810 CTGGCTGTAAATGGTTCAAAAGG + Intergenic
1125787044 15:42328404-42328426 CCTGCTTTAGATGGTTCTAAAGG + Intronic
1133690808 16:8213234-8213256 CCGGCTCTCAGGGGTTTTATAGG - Intergenic
1140843996 16:78869375-78869397 CCTACTCAAAATGGTTTTTATGG + Intronic
1151076175 17:71275352-71275374 CCAACACTAAATGGTTCTAAAGG + Intergenic
1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG + Intergenic
1153631112 18:7070842-7070864 CCGGCTTTAAAAGTTTTTTAAGG + Intronic
1159797971 18:72867322-72867344 CCGTCTCTAAATGGAATTAGTGG - Exonic
1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG + Intronic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1164815472 19:31197829-31197851 CCAGCTCTAGATGGCTTTACTGG + Intergenic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
1168232054 19:55038885-55038907 CCGGCTATAATTTTTTTTAATGG + Intergenic
932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG + Intronic
934975299 2:98798041-98798063 CCAACTCTATATGGTTTCAAAGG - Intronic
935050251 2:99519066-99519088 CCGGCCTTTAATGCTTTTAAAGG - Intergenic
935568916 2:104638525-104638547 ACAGCTCTAAATGGTCTTTAAGG + Intergenic
939761344 2:146184719-146184741 CCAGGTCTAGATGGTTTTACAGG - Intergenic
948246067 2:236487191-236487213 ACGGCACTTCATGGTTTTAAAGG + Intronic
1172804908 20:37604838-37604860 CCCGATCTAAATGATTTTAAAGG - Intergenic
1176418184 21:6491899-6491921 CCAGCTCTAGACTGTTTTAAAGG + Intergenic
1179693677 21:43100221-43100243 CCAGCTCTAGACTGTTTTAAAGG + Intronic
953303166 3:41799559-41799581 TCGCCTCTAAATTGTTTTTAAGG + Intronic
954944886 3:54413678-54413700 CAGTCACTAAATGATTTTAATGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
966192263 3:177281887-177281909 ACTGCTCTAAATGATTTTAAAGG + Intergenic
973294068 4:48496090-48496112 GCTGCACTAAAAGGTTTTAAAGG + Intergenic
977992214 4:103457883-103457905 CCTGCTCTAAGTGGTTTTGGAGG + Intergenic
980195027 4:129577769-129577791 CCTGCAATAAATGGATTTAACGG - Intergenic
984342231 4:178471811-178471833 TCTGTTCTAAATGGTATTAAGGG - Intergenic
984942585 4:184946730-184946752 CCTGCTTTAAAAGGATTTAAGGG - Intergenic
985515209 5:340143-340165 CCAGGTCTAAATGGTTTCACTGG - Intronic
991034308 5:62112765-62112787 CCTGCTTAAAATGCTTTTAAAGG + Intergenic
993631411 5:90290527-90290549 CAGGCTCTCAATGGTGTAAAAGG - Intergenic
995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG + Intergenic
996015256 5:118526502-118526524 CCACATCAAAATGGTTTTAACGG + Intergenic
1001804473 5:174571456-174571478 CCAACTCAAAATGGTTTAAAAGG - Intergenic
1003672300 6:8170748-8170770 CAGGTTTTATATGGTTTTAAAGG + Intergenic
1003710197 6:8580989-8581011 CTGGCTCTATATTTTTTTAAAGG - Intergenic
1003793646 6:9575652-9575674 CAGGCTCCAAATGGTTTTGATGG + Intergenic
1006292624 6:33151675-33151697 CCATCTCAAGATGGTTTTAATGG - Intergenic
1006415494 6:33901425-33901447 CCTGCCCTGAATGGTGTTAAAGG - Intergenic
1021228309 7:18054631-18054653 CAGGATCTAAATTGTTTTACTGG + Intergenic
1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG + Intronic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1026531391 7:71200455-71200477 ACTGGTGTAAATGGTTTTAATGG + Intronic
1028340493 7:89713370-89713392 ACTGCTCTAAATAGTATTAAAGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030774625 7:113518618-113518640 ACAGTTTTAAATGGTTTTAAAGG - Intergenic
1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG + Intronic
1041042267 8:53859419-53859441 CAGATTTTAAATGGTTTTAATGG + Intronic
1041185191 8:55292265-55292287 CCAGGTCTAAATGGTTTTATTGG - Intronic
1045831134 8:106461635-106461657 CAGGCTTAAAATAGTTTTAAAGG - Intronic
1053559730 9:39178279-39178301 ACGTCTCTTATTGGTTTTAAAGG + Exonic
1054137385 9:61440664-61440686 ACGTCTCTTATTGGTTTTAAAGG - Intergenic
1059982258 9:119785815-119785837 CATTCTCAAAATGGTTTTAAAGG + Intergenic
1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG + Intronic
1187878394 X:23823471-23823493 CCGGCACCAAAGGGTTTTATTGG + Intergenic
1195406341 X:104518230-104518252 CCAGGCCTAAATGGTTTTACTGG - Intergenic