ID: 1029675294

View in Genome Browser
Species Human (GRCh38)
Location 7:102064535-102064557
Sequence CCTCCAAGGCATGCAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 3, 1: 0, 2: 2, 3: 15, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675286_1029675294 18 Left 1029675286 7:102064494-102064516 CCCTTCTCAGAGGGAGCTGTGTT 0: 3
1: 0
2: 0
3: 21
4: 218
Right 1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG 0: 3
1: 0
2: 2
3: 15
4: 209
1029675283_1029675294 23 Left 1029675283 7:102064489-102064511 CCCTCCCCTTCTCAGAGGGAGCT 0: 3
1: 0
2: 1
3: 25
4: 302
Right 1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG 0: 3
1: 0
2: 2
3: 15
4: 209
1029675284_1029675294 22 Left 1029675284 7:102064490-102064512 CCTCCCCTTCTCAGAGGGAGCTG 0: 3
1: 0
2: 6
3: 48
4: 790
Right 1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG 0: 3
1: 0
2: 2
3: 15
4: 209
1029675289_1029675294 -6 Left 1029675289 7:102064518-102064540 CCAAGCCTTGGCTTGTACCTCCA 0: 1
1: 2
2: 0
3: 19
4: 208
Right 1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG 0: 3
1: 0
2: 2
3: 15
4: 209
1029675285_1029675294 19 Left 1029675285 7:102064493-102064515 CCCCTTCTCAGAGGGAGCTGTGT 0: 3
1: 0
2: 2
3: 23
4: 259
Right 1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG 0: 3
1: 0
2: 2
3: 15
4: 209
1029675287_1029675294 17 Left 1029675287 7:102064495-102064517 CCTTCTCAGAGGGAGCTGTGTTA 0: 3
1: 0
2: 0
3: 20
4: 139
Right 1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG 0: 3
1: 0
2: 2
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675294 Original CRISPR CCTCCAAGGCATGCAGTGGA TGG Intronic
900001820 1:18649-18671 CCTCCAGGGCACACAGAGGATGG + Intergenic
900021540 1:189172-189194 CCTCCAGGGCACACAGAGGATGG + Intergenic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
901321547 1:8343246-8343268 CCAGCATGGCATGCAGGGGAGGG + Intronic
901825977 1:11861492-11861514 CCTCCAAGGCCTGCTGTCCAGGG + Intergenic
901858563 1:12059705-12059727 CCTCCAGAGCAAGCTGTGGAAGG - Intergenic
902441424 1:16432656-16432678 CCTCAAAGGAATTCAGTGGCTGG - Intronic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903660019 1:24971331-24971353 CCTCCAAGGCCTGCTGTGAGGGG + Intergenic
910490600 1:87765277-87765299 TCTCCATGGCATCCAGTGAAAGG + Intergenic
915807003 1:158864640-158864662 CCGCCAAGCCAGGCATTGGAGGG - Intergenic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918602019 1:186375349-186375371 CCTACAAGGCCTGAAGTGGGTGG - Intronic
919482740 1:198109433-198109455 AGTACTAGGCATGCAGTGGAGGG - Intergenic
920732077 1:208496877-208496899 TCTGCCAGGCATGGAGTGGAAGG + Intergenic
921222944 1:212986669-212986691 TCTCCAGGGCATGCAGAGGCTGG + Intronic
922482808 1:225950859-225950881 CCTCCAAGGCTGACAGTGAAGGG + Intergenic
1063374646 10:5546762-5546784 CCTCCCAAGGATGCAGTTGAAGG + Intergenic
1065589689 10:27252027-27252049 ACTCCAGGGCCTGCAGTGGTGGG + Intergenic
1067165627 10:43864423-43864445 CACCCAAGGCAGGCAGTGGTGGG - Intergenic
1069643135 10:69969363-69969385 CCACCAAGCCATGCACTGAAGGG - Intergenic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1070696498 10:78567724-78567746 CCTTCAAAGCATGCATTTGAGGG + Intergenic
1072850168 10:98881881-98881903 CTTCCAATGGATGCAGGGGAGGG - Intronic
1074291838 10:112143494-112143516 CCTCAAGGGCATGCTTTGGAGGG - Intergenic
1074291841 10:112143495-112143517 CCTCCAAAGCATGCCCTTGAGGG + Intergenic
1075140754 10:119832979-119833001 CCTCCAGGTCATGCAGAGGTGGG - Intronic
1076224950 10:128766677-128766699 CATCCAAGGTAGGCAGTAGAGGG - Intergenic
1078589586 11:12627706-12627728 CCTCCAAGTCATGCCTTTGAAGG + Intergenic
1079203680 11:18395718-18395740 CCTCCAGCGAATGCAGTGCAGGG + Intronic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1082127848 11:48453759-48453781 CCACCAAGCCAGGCACTGGAGGG + Intergenic
1082287520 11:50333690-50333712 GCTCCAAGGCCTGGTGTGGAAGG - Intergenic
1082855589 11:57803673-57803695 CTGTCAAGGCATGCAGTGCATGG - Exonic
1083933253 11:65857489-65857511 CCTCCAAGCCTTGCGGTGCAAGG + Intronic
1085123379 11:73981692-73981714 CCTCCAAGGCATGGATTGGGTGG - Intronic
1085477580 11:76797733-76797755 CCTCCCAGGAATGCCGTGAAAGG + Exonic
1087726538 11:101723920-101723942 CATCCAAGGCCTGAAGTGGGTGG + Intronic
1090590492 11:128261864-128261886 GCTTCAGGGCCTGCAGTGGATGG - Intergenic
1091374901 12:18754-18776 CCTCCAGGGCACACAGAGGATGG + Intergenic
1091613654 12:2032939-2032961 CCTCGAAAGCAAGCACTGGAGGG - Intronic
1091801153 12:3325447-3325469 CCTTCCAGGCATGCTGTAGAGGG - Intergenic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1094607963 12:31965585-31965607 CCTCTAAACCATGCAGTTGAGGG - Intronic
1095082947 12:38028938-38028960 AATCCAAGGCATCCATTGGATGG + Intergenic
1095672504 12:44876777-44876799 CCTCCAGGGCGTGCGGAGGAAGG + Exonic
1095896170 12:47282449-47282471 ACTCCAAGATGTGCAGTGGAAGG + Intergenic
1095918442 12:47504456-47504478 ACTCCAAGGCATGAAATGGGAGG - Intergenic
1103043119 12:117712138-117712160 CCTCCTAGGCAAGAAGTGGCAGG + Intronic
1103761528 12:123253821-123253843 CATCCAAGGAAAGCAGTGCAGGG - Exonic
1104621013 12:130312913-130312935 CTTCCAAGGCATGCAGGGGATGG - Intergenic
1106801017 13:33255739-33255761 CCTCCAGGGCAGGGAGGGGACGG + Intronic
1107008751 13:35646246-35646268 CCTCCATGGCCTGCAGGGGAAGG - Exonic
1111878750 13:93929152-93929174 CCTGAAAGGCAAGCAGTGAAAGG - Intronic
1111897612 13:94160542-94160564 CCTGCAACCCATGCAGTGCATGG - Intronic
1112895605 13:104296174-104296196 CCTTCAATGCATGCAGTGAGTGG + Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1118304055 14:64639788-64639810 TCTGCAAGACTTGCAGTGGAGGG + Intergenic
1119168426 14:72514731-72514753 CCTCCATGGCTTGCAGCAGAAGG - Intronic
1119758050 14:77132573-77132595 TCTGCCAGGCATGCTGTGGAAGG - Exonic
1120000831 14:79301604-79301626 CCTCCAAGGGATGATGTGCAAGG - Intronic
1122402192 14:101474034-101474056 CCTCCACGGCATCCCGGGGAAGG + Intergenic
1125081706 15:35681714-35681736 ACTCCAAGGGATGTATTGGAAGG + Intergenic
1125514500 15:40310175-40310197 CCTCCAGGGTGGGCAGTGGAAGG + Intergenic
1125654001 15:41341010-41341032 CCACCCAGCCATGCAGTTGAGGG - Intronic
1125724406 15:41861014-41861036 CCTCCAGGGAGTGCAGAGGAGGG - Intronic
1129345395 15:74914723-74914745 CATCCAAGTCAAGCTGTGGAAGG + Intergenic
1129467912 15:75734186-75734208 CCTCTGTGGCAGGCAGTGGAGGG - Intergenic
1129669971 15:77602194-77602216 CCTCCAGGGAATGCAGTGTGGGG - Intergenic
1129719348 15:77869545-77869567 CCTCTGTGGCAGGCAGTGGAGGG + Intergenic
1129897991 15:79122787-79122809 CCTCCAGGGGGTGCAGGGGAAGG + Intergenic
1132233326 15:100200738-100200760 CATCCAGGGCATGGAGTTGACGG - Intronic
1132451689 15:101972291-101972313 CCTCCAGGGCACACAGAGGATGG - Intergenic
1132455203 16:18338-18360 CCTCCAGGGCACACAGAGGATGG + Intronic
1136576429 16:31127967-31127989 GCTCCAAAGCATGCAGTGGTGGG + Intronic
1138314750 16:56060349-56060371 CCTTCAAGATATGCAATGGATGG - Intergenic
1138379654 16:56591037-56591059 CCTCCAAGGTCAGCAGGGGAAGG - Exonic
1138659269 16:58508100-58508122 CCTCCAGGGCCAGCAGTGGACGG + Intronic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1139600522 16:67983767-67983789 TCTCTAAGGCATGGAGTTGAGGG + Intergenic
1139852813 16:69961171-69961193 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1139881784 16:70184079-70184101 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1140370725 16:74411427-74411449 CCTGCAAGGCAACCAGTGGCTGG + Intronic
1141591725 16:85073631-85073653 CCTCCAAGGTGTGAAATGGAGGG + Intronic
1142970321 17:3606884-3606906 CCTGCCCAGCATGCAGTGGATGG - Intergenic
1144782895 17:17816785-17816807 CCTCCAGAGCCTGCTGTGGACGG - Intronic
1147050454 17:37790495-37790517 CCTCCACACAATGCAGTGGATGG - Intergenic
1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG + Intergenic
1149154280 17:53607774-53607796 AATGCATGGCATGCAGTGGAAGG - Intergenic
1149585862 17:57786030-57786052 CCTCCTAGCCAGGCAGTGGGGGG - Intergenic
1149597992 17:57875287-57875309 CCACCCAGGAAAGCAGTGGAGGG + Intronic
1149954692 17:61035703-61035725 CATCCAAGACCTCCAGTGGATGG + Intronic
1151430009 17:74056006-74056028 CCTCCAAGGCTGGCACCGGATGG + Intergenic
1155395972 18:25387191-25387213 CCCCAAATGCATGCAGTGAAAGG + Intergenic
1155628546 18:27864183-27864205 CTTCCAAAGCACACAGTGGATGG + Intergenic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1160159316 18:76459428-76459450 CCTCCCTGGCCGGCAGTGGAGGG - Intronic
1160633572 19:60257-60279 CCTCCAGGGCACACAGAGGATGG + Intergenic
1161717064 19:5882198-5882220 ACTCCCAGGCTTGCAGTGGGCGG + Intronic
1162155908 19:8677800-8677822 CCTCCTAGGGGTGGAGTGGATGG + Intergenic
1162673718 19:12282207-12282229 TGTCTAAGGCATGCAGTGTATGG + Intronic
1163182541 19:15614761-15614783 CCTGCCAGGCTGGCAGTGGAGGG + Intergenic
1163717463 19:18880308-18880330 CTGCCAAGGCATGCAGCCGATGG + Exonic
1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG + Intergenic
1164476198 19:28577825-28577847 CCCCTCTGGCATGCAGTGGAAGG + Intergenic
1164618428 19:29680229-29680251 CCTCCAGGCCAGGCTGTGGATGG + Intergenic
1164972177 19:32542001-32542023 CTTCCAAGCCATCCAGTGGGAGG + Intergenic
1168276058 19:55279455-55279477 CCTCCAAGGCTTGCTGCAGATGG - Exonic
1168311595 19:55463582-55463604 CCCCCAGGGCATGCTGGGGAAGG + Intergenic
929863820 2:45700951-45700973 CCTCCAAGGCATCTAAAGGAGGG - Intronic
930326709 2:49929048-49929070 CCACCAAAGCATGCATTTGAAGG + Intronic
933383145 2:81576752-81576774 CCTCCAAAAATTGCAGTGGATGG + Intergenic
934983747 2:98869395-98869417 CCTTCAGGGCTTGGAGTGGAAGG - Intronic
935200721 2:100854251-100854273 GCTCCTAGGCATGGAGTGGGAGG + Intronic
935953399 2:108351403-108351425 CTTCCAAGGACTCCAGTGGAGGG + Intergenic
936567900 2:113594758-113594780 CCTCCAGGGCACACAGAGGATGG - Intergenic
936666944 2:114607915-114607937 CCTCCAACCCCTGCACTGGATGG - Intronic
937246984 2:120499935-120499957 GCTCAAAGGCATGGAGTGCAGGG - Intergenic
937291573 2:120785195-120785217 CCTCCTGGGCATGCAGAGGAAGG + Intronic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938379409 2:130828185-130828207 CCTCCAAGGCATCCTGGTGATGG - Intergenic
938404964 2:131027080-131027102 CCTCCTGGGCATGCGTTGGAGGG - Intronic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
948943419 2:241207552-241207574 CCTGCAAGGCATGGAGCGGAGGG - Exonic
1171212139 20:23325260-23325282 CCTGCAGGGATTGCAGTGGATGG - Intergenic
1171419225 20:25006649-25006671 CCTGCTAGGCATGCAGGGGCTGG - Exonic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172931871 20:38592114-38592136 CCTCCAAACCCTGCAGAGGAAGG + Intergenic
1173585234 20:44177211-44177233 CCTCCAAGGCAGGAAGTCTATGG + Intronic
1174849281 20:53976435-53976457 CCTTTAAGGCATCCAGGGGAGGG + Intronic
1175940540 20:62535702-62535724 CCTCCAAGAATTGCAGTTGAGGG + Intergenic
1178222669 21:30677892-30677914 TTTCCCAGTCATGCAGTGGAGGG - Intergenic
1179722959 21:43325748-43325770 ACCCCAAGGCATGCAGTGAGTGG + Intergenic
1180256102 21:46628786-46628808 CCACCAAGATATGCGGTGGAAGG - Intergenic
1180258737 21:46651539-46651561 TCTCCAGTGCAGGCAGTGGAGGG + Intronic
1182270618 22:29150978-29151000 CCTCCAACACAGGCAGTGGGTGG + Intronic
1183774657 22:39956044-39956066 CCTCCAGAGCATGCAGCTGAAGG + Intronic
1184405211 22:44296989-44297011 CCACAAAGGCATCCAGGGGAGGG - Intronic
1203278603 22_KI270734v1_random:110139-110161 CCTGCAAGGGGTGCAGAGGAGGG + Intergenic
952762822 3:36930210-36930232 CCTTCAAGGCCTGCAGTGATGGG - Intronic
953492244 3:43362163-43362185 TCTCCAAGGCTTACAGAGGATGG + Intronic
953575019 3:44106051-44106073 CTTTCAAGGCTTGCAGGGGAGGG + Intergenic
954540268 3:51389055-51389077 CCCCCAAGGCAGCCAGTGCACGG + Exonic
955190044 3:56752947-56752969 CCTCCAAGCCATGGAGTTGGGGG + Intronic
956187823 3:66579294-66579316 CTTCCAAGGCATGAAGTTCATGG - Intergenic
956240334 3:67122992-67123014 CCTCCAAGGGATGCATGGGGTGG + Intergenic
958806135 3:98813130-98813152 CATCCAAGGAATGCATTGGCGGG + Intronic
960518000 3:118623476-118623498 CCCCCAAAGCCTGCAGTGGAAGG + Intergenic
960735302 3:120772868-120772890 CATCCAAGGCCTGCAGTGAGTGG - Intronic
960863258 3:122174073-122174095 CCTCCAAGTGCTCCAGTGGAAGG - Intergenic
969248942 4:5954581-5954603 CCTCCACGGCAGGCAGCGCATGG + Intronic
972326553 4:38021945-38021967 CCTCCAAGGTATTCTGAGGATGG + Intronic
974021039 4:56692721-56692743 CCTCCAAGGACTGCAGAGCAAGG - Intergenic
981104727 4:140867405-140867427 CCTCCAAGGCATCCAGTCTTTGG - Exonic
985007990 4:185553699-185553721 CATCCTTGTCATGCAGTGGAGGG + Intergenic
985668809 5:1195973-1195995 CCTCCCAGGCACGCAGTCGACGG + Intergenic
985668820 5:1196019-1196041 CCTCCTGGGCATGCAGTCGACGG + Intergenic
985668831 5:1196065-1196087 CCTCCCGGGCACGCAGTCGACGG + Intergenic
985668843 5:1196111-1196133 CCTCCCGGGCACGCAGTCGACGG + Intergenic
985668852 5:1196153-1196175 CCTCCCAGGCACGCAGTCGATGG + Intergenic
985959185 5:3286833-3286855 CATCCCAGGCATGCAGTTGGAGG - Intergenic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
992107048 5:73458147-73458169 CTTCCAAGACAATCAGTGGAAGG + Intergenic
992357215 5:75998439-75998461 CCCTGAAGTCATGCAGTGGAAGG + Intergenic
1000019113 5:157303689-157303711 CCTGCAGGGTATGCAGAGGAGGG - Intronic
1000027113 5:157368848-157368870 CCTCCAAGCCCTCCAGTGGTGGG + Intronic
1001199060 5:169699432-169699454 CCTCCAAGGGGGACAGTGGAGGG + Exonic
1002476427 5:179469018-179469040 CTGCCAAGGCATGAAGTGGGAGG - Intergenic
1002638232 5:180618534-180618556 CAGACAAGGCAGGCAGTGGAGGG - Intronic
1003228187 6:4225286-4225308 CCACCAAGCCAGGCATTGGAGGG - Intergenic
1006056863 6:31391538-31391560 CATCCAGGGCGTGCAGGGGAGGG - Intergenic
1006803078 6:36771749-36771771 CCTCCAGGGTAGGCAGGGGAGGG - Intronic
1007060161 6:38932700-38932722 GCAGCAAGGCATGAAGTGGATGG + Intronic
1007829128 6:44624917-44624939 CCTCCAGGGCATCCAGTAGGTGG - Intergenic
1009412033 6:63377336-63377358 CCTTCAGGGCATGCAGTTGATGG - Intergenic
1010123905 6:72411046-72411068 CCTCCAAGTGATGCAGGGGTTGG + Intergenic
1010324351 6:74547821-74547843 CTTCCATAGCCTGCAGTGGAAGG + Intergenic
1010339546 6:74732294-74732316 CCTCGTAGGCATTCAGTGAATGG - Intergenic
1013341561 6:109220731-109220753 CCTCCCAGCCGTGCAATGGAGGG + Intergenic
1014196358 6:118564126-118564148 CCTCAAAGCAATGCAGAGGAGGG - Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1019774086 7:2901937-2901959 CCTCCAAGGAAATCAGTGCATGG + Intergenic
1021822389 7:24511157-24511179 CCTCCATCACATCCAGTGGAAGG + Intergenic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1023282308 7:38583767-38583789 CCTCCAGGGCACCCAGTGCATGG - Intronic
1023660865 7:42469664-42469686 ACTGCACGGCATGCAGCGGAGGG - Intergenic
1024211915 7:47213395-47213417 CCTAAAAGGCACTCAGTGGAAGG - Intergenic
1024516901 7:50266993-50267015 GCTGCAAGGCATGCTGGGGAGGG - Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1028289148 7:89044093-89044115 CCTGGGAGGCATTCAGTGGAAGG + Intronic
1028994523 7:97085633-97085655 CCTCTCAGGCATGGAGTAGAGGG + Intergenic
1029458012 7:100680677-100680699 CCTCAAAGGCAAGGAGTGGGTGG - Exonic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1031682099 7:124687792-124687814 CCACCAAGGAAAGCAGTGAAGGG + Intergenic
1031818995 7:126474695-126474717 CTTCCTAGGCTTGCAGGGGAGGG + Intronic
1034955787 7:155333777-155333799 CCTTCGAGGCATGCTGTGCAGGG + Intergenic
1035626150 8:1072120-1072142 CCGTCAAGGCACACAGTGGAGGG + Intergenic
1035732044 8:1860264-1860286 CATCCGGGGCATGCAGAGGAGGG - Intronic
1037941202 8:22952329-22952351 CATGCATGGCATGCAGAGGAGGG - Intronic
1038492875 8:27982673-27982695 CCGCCCAGGCATGCAGAGAAGGG + Intronic
1040535572 8:48306493-48306515 CCTCCAAGACAAAGAGTGGACGG + Intergenic
1043034540 8:75179310-75179332 CTGCCAAGGCATGCAGCAGAGGG - Intergenic
1044472751 8:92589511-92589533 CCTAAAAGGAATTCAGTGGAAGG + Intergenic
1044546683 8:93467407-93467429 CCTCCAAGGAACGCAGTTCATGG + Intergenic
1044960666 8:97528081-97528103 CCTCCAAGGAACGCAGTTCATGG - Intergenic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1049884628 9:18762-18784 CCTCCAGGGCACACAGAGGATGG + Intergenic
1052746687 9:32448476-32448498 CCACCAAGCCAGGCACTGGAGGG + Intronic
1053209742 9:36217701-36217723 CATCCACGGCATGCAGTGGGAGG + Intronic
1056183255 9:84106077-84106099 CTTGCAAGGCAGGCAGTGTATGG + Intergenic
1056710018 9:88984709-88984731 ATTCAATGGCATGCAGTGGATGG - Intergenic
1057821227 9:98332596-98332618 CCTCCAAAGCACACAGTGCAGGG + Intronic
1058096143 9:100862482-100862504 CCTCCTGGGAAGGCAGTGGAGGG - Intergenic
1059495197 9:114703364-114703386 CTTCCAAGGCCTGCAGTAAAAGG - Intergenic
1061074641 9:128333679-128333701 CCTCCAAGGGAAGCAGGGGATGG - Exonic
1061665864 9:132160999-132161021 CCTCCCATGCTTGCAGGGGAGGG + Intergenic
1062106478 9:134757734-134757756 GCTCCAGGGCATGCAGAAGAGGG + Intronic
1190329503 X:49226894-49226916 CATCTAAGGCATGCAGGGAATGG + Intronic
1190822301 X:53985172-53985194 CATCCAGGGCATGCTGTGCATGG - Exonic
1194035786 X:88869722-88869744 CCTGCAAGGGATGCAATGTATGG - Intergenic
1195079497 X:101357511-101357533 TATCCCAGGCCTGCAGTGGAAGG + Exonic
1195960208 X:110378292-110378314 GCCCCAAGGGATGGAGTGGAGGG - Intronic
1199041232 X:143117267-143117289 CCTACAAAGCATTCAGTAGAAGG - Intergenic
1199597070 X:149514513-149514535 CCTCCAAGGAAAACCGTGGATGG + Intronic
1199934286 X:152556033-152556055 CCTGGATGGCATGCAGTGTAGGG - Intergenic
1200401176 X:156021389-156021411 CCTCCAGGGCACACAGAGGATGG - Intergenic