ID: 1029675399

View in Genome Browser
Species Human (GRCh38)
Location 7:102065036-102065058
Sequence GGTGAGCTGCAGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 3, 1: 0, 2: 4, 3: 122, 4: 781}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675394_1029675399 -9 Left 1029675394 7:102065022-102065044 CCTACCACAGACTGGGTGAGCTG 0: 3
1: 0
2: 2
3: 16
4: 203
Right 1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG 0: 3
1: 0
2: 4
3: 122
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675399 Original CRISPR GGTGAGCTGCAGAGGGAGGA TGG Intronic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900241804 1:1620817-1620839 GGGGAGCTGCTGGGGCAGGAGGG + Intronic
900400440 1:2470841-2470863 GAGGAGCTGCAGAGGGAGCCAGG - Intronic
900459660 1:2796741-2796763 CGTGAGCTTCTGAGGAAGGAGGG - Intronic
900544531 1:3221048-3221070 AGTGAGGTGGAGAGGGGGGACGG + Intronic
900725875 1:4216120-4216142 GGGGAGGTGCAAAGAGAGGAGGG - Intergenic
900802711 1:4747324-4747346 GGTGAGGTGGAGAGGGGGGATGG - Intronic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
901009568 1:6192152-6192174 GGGGAGCTGAAGTGGGAGGATGG - Intronic
901220796 1:7582767-7582789 GGCTAGCTGCAGAGGGAGCTGGG + Intronic
901261782 1:7876426-7876448 CATGTGCTGCAGAGGGGGGAGGG + Intergenic
901300529 1:8197030-8197052 GGAGAGCAGGAGGGGGAGGAGGG + Intergenic
902331921 1:15735058-15735080 GGTGGGCTGCAGATGGTGGGCGG - Intergenic
902823396 1:18956743-18956765 GGAACGCCGCAGAGGGAGGAGGG - Intergenic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903548645 1:24142658-24142680 AGTGAGAGGCAGAGGAAGGATGG + Intronic
903579378 1:24359381-24359403 GGTGAGCTCCAGAGAGGGTAGGG - Intronic
904004758 1:27357888-27357910 GGCGAGCTGCTGATTGAGGACGG + Intronic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904489158 1:30847632-30847654 GGGGAGCTGCAGGGAGGGGAGGG - Intergenic
904521755 1:31101271-31101293 GGTGGGGTAGAGAGGGAGGAAGG + Intergenic
904948113 1:34214179-34214201 AGTGAGCAGCACTGGGAGGAGGG + Intronic
905004216 1:34697309-34697331 GGTGACCTGGGAAGGGAGGAGGG - Intergenic
905095489 1:35466558-35466580 GGAGTCCTGCAGAGGGAGGAAGG + Intronic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905189692 1:36224192-36224214 GGTGGCCTGGAGATGGAGGAGGG - Intergenic
905480755 1:38260474-38260496 GGAGAGGAGGAGAGGGAGGAAGG - Intergenic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905803683 1:40861563-40861585 CGTGAGCTGCTGAGGGCGGCCGG - Exonic
906140534 1:43531363-43531385 GGTGCGGTGGAGAGGGAGGGAGG - Intronic
906322737 1:44827077-44827099 GGTCAGCTGCAGAGGCAGAGAGG + Exonic
906323990 1:44832939-44832961 GGTGTGGGGGAGAGGGAGGATGG + Intronic
907246584 1:53113038-53113060 GGAAAGCTGCAGTGGGAAGAGGG - Intronic
907438736 1:54465429-54465451 TGAGAGCTCCAGCGGGAGGAGGG - Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908711580 1:67021552-67021574 GGTGAACTGCAGAAGAAAGAGGG + Exonic
908843884 1:68305088-68305110 GGAGAGATGCAGTGGGAGGCAGG - Intergenic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910667070 1:89737158-89737180 GGTGCTGTGCAGAGGCAGGATGG - Intronic
910715137 1:90222410-90222432 GGTGAGGCTCTGAGGGAGGAAGG + Intergenic
910819255 1:91328531-91328553 GATGTGCTGCAGAACGAGGAGGG + Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
911661751 1:100509169-100509191 GGTGAGAAGCAAAGGGAGGGAGG - Intronic
912206589 1:107515883-107515905 GGGGTGCTGCCCAGGGAGGAAGG - Intergenic
915106385 1:153537251-153537273 GGTCAGCAGCAAAGGGTGGAGGG + Exonic
915107331 1:153542617-153542639 GGTCAGGTGCAGAGGCTGGAGGG - Intergenic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
917546469 1:175973991-175974013 ATTGAGCTGGAGAGGGAGGTGGG + Intronic
918048468 1:180955018-180955040 GGTGAGCTGCAGAGGGACCCAGG - Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918130138 1:181620213-181620235 GGTGAGCTGGTGAGGGAAGGGGG + Intronic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
918266205 1:182844444-182844466 GAAGAGCTGAAGTGGGAGGATGG - Intronic
918658656 1:187061927-187061949 GGTGAGTTGCAGAGAGGTGATGG + Intergenic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919860627 1:201737533-201737555 GGTGAGACACACAGGGAGGAGGG + Intronic
920366393 1:205450353-205450375 GGGGAGCGGCAGGGGAAGGAAGG - Intronic
920374278 1:205498993-205499015 GATGAGCTGACGAGGGAGGCAGG + Intergenic
920500075 1:206480243-206480265 GGTGGGCAGGAGAGGGAGGTGGG + Intronic
920552003 1:206869812-206869834 GGTGCGCTTCAGAGTGAGGTGGG - Intergenic
921184098 1:212655520-212655542 GATGGCCTGCAGAGGGAGGGAGG + Intergenic
921676612 1:217983161-217983183 AGTGAGCTGTTGAGGGAGGAGGG + Intergenic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
922455451 1:225770451-225770473 GGGGTGCTGCAGGGGGAAGAGGG - Intergenic
922707223 1:227795833-227795855 GGGGAGCTCCTGAGGAAGGAGGG - Intergenic
922858316 1:228794132-228794154 GGAGAGTTTCAGAGAGAGGAAGG + Intergenic
923384471 1:233452996-233453018 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
924191529 1:241557721-241557743 GGTAGGCTGAGGAGGGAGGATGG + Intronic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
924908737 1:248485796-248485818 TGTAGACTGCAGAGGGAGGATGG + Intergenic
924915371 1:248562266-248562288 TGTAGACTGCAGAGGGAGGATGG - Intergenic
924939746 1:248804752-248804774 GGTGGGCTGCAGAGGCAGGTGGG + Intergenic
924947779 1:248857785-248857807 GGTGAGAGCCAGAGGGAAGAGGG - Intronic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063427617 10:5962205-5962227 AGTCACCTGCACAGGGAGGAAGG - Intronic
1063779406 10:9304124-9304146 GGAGAGCAGGAAAGGGAGGATGG - Intergenic
1063908970 10:10810651-10810673 GGAGACCGGCAGAAGGAGGAAGG + Intergenic
1063948192 10:11197680-11197702 GGTCGGTGGCAGAGGGAGGAGGG + Intronic
1064265368 10:13821246-13821268 GCTGTGCTGGAGAGGCAGGAAGG - Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1064906839 10:20356383-20356405 GGGGAGCTGAGGTGGGAGGATGG - Intergenic
1065332530 10:24617061-24617083 GGTGAGCAGCGGGGGAAGGAGGG + Intronic
1065517244 10:26536694-26536716 GGTGGGCTGAGGTGGGAGGATGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065818290 10:29501450-29501472 GGTGAGGAGTGGAGGGAGGAAGG + Intronic
1065865453 10:29911154-29911176 GGTGAGGTGCAGAGCGTGGAAGG - Intergenic
1065954621 10:30683051-30683073 GGTGAGGAGTGGAGGGAGGAAGG - Intergenic
1066200954 10:33142330-33142352 AGGGAGCTGCTGATGGAGGAGGG + Intergenic
1067059465 10:43070567-43070589 TGTGAGCTGCAGGGACAGGAGGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067524101 10:47028051-47028073 GGGGGGCTGCAGAGGCAGGTGGG - Intergenic
1068007232 10:51406053-51406075 GGATCGCTGCAGAGAGAGGAAGG - Intronic
1068773443 10:60847259-60847281 GGGGAACTGCAGAGGGTGGTTGG + Intergenic
1069604837 10:69732550-69732572 GGTGGGGTCCAGAGAGAGGAGGG - Intergenic
1069623139 10:69850083-69850105 GGTGAGCTGGAGGTGGAGGGAGG + Intronic
1070555768 10:77526857-77526879 GGAGATATGGAGAGGGAGGATGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1073035752 10:100563106-100563128 GGAGAGCTGGAGATGGAGGTTGG + Intergenic
1073473421 10:103737954-103737976 GGTGAGCTGCAGAGCCATCATGG - Intronic
1074147438 10:110729357-110729379 GGTGAGAAGGAGAGGCAGGAAGG - Intronic
1074182378 10:111076521-111076543 GGGGTCCTGGAGAGGGAGGAAGG - Intergenic
1074339738 10:112615858-112615880 AGTGAGGTGCACAGGGAGTAAGG + Intronic
1074721110 10:116265949-116265971 AGAGAACTGCAGAGGGAGGGTGG - Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075627378 10:123972660-123972682 GGTGAGCGGCAGGGCGGGGATGG + Intergenic
1076323617 10:129602742-129602764 GTTGAGCTGGAAAGGAAGGAGGG - Intronic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1077023451 11:429853-429875 GGTGAGCTGGGGAGGGGGGCAGG + Intronic
1077264109 11:1640619-1640641 GGAGGGCTGCAGGGGGAAGAGGG + Intergenic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077330457 11:1981906-1981928 GATGCGCTGCAGAGGGAGAGGGG - Intronic
1077478715 11:2803101-2803123 GGTGAGGGGCAGAGTGAGCAAGG + Intronic
1077525136 11:3059629-3059651 GGGAGGCTGAAGAGGGAGGATGG + Intergenic
1077532498 11:3103787-3103809 AGAGGGCTGCAGAGGCAGGAAGG - Intronic
1077532529 11:3103907-3103929 GATGGGCTGCAGAGGCAGGAAGG - Intronic
1078059224 11:8032666-8032688 CGGGAGGTGCAAAGGGAGGAGGG - Intronic
1078345163 11:10541273-10541295 GGGGCGCTGCAGAGGAAGGTTGG - Intergenic
1078849383 11:15150086-15150108 GGTGAGCAACAGAGAGAGGGTGG + Intronic
1079010056 11:16820687-16820709 AGTGAGCTGCAGAGCCAGGCAGG - Intronic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080539062 11:33249499-33249521 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
1080721653 11:34855043-34855065 GATGAACTGCAGAGAGAGAAAGG + Intronic
1081701552 11:45155640-45155662 GGAGGGGTGGAGAGGGAGGAAGG + Intronic
1081912254 11:46707204-46707226 GGAAAGGTGGAGAGGGAGGAGGG + Intergenic
1081963468 11:47155095-47155117 GGAGAGAGGGAGAGGGAGGAAGG - Intronic
1081998445 11:47378747-47378769 GCTAAGCTGGGGAGGGAGGATGG + Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083226175 11:61286292-61286314 GGTGAGCTGCAGAGAAGGAATGG - Exonic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1083878176 11:65535678-65535700 GGTCAGCTGGGCAGGGAGGAAGG + Intronic
1083987063 11:66222439-66222461 TGTGATCTGCTGAGGGAGCAGGG - Intronic
1084640603 11:70423702-70423724 GCCTAGCTGCAGAGGGAGGGTGG + Intronic
1084683637 11:70681197-70681219 GCTGAGCAGCAGAGAGAGAACGG - Intronic
1084876131 11:72135308-72135330 GGTCAGCGGCAAACGGAGGAGGG - Intronic
1084880995 11:72171787-72171809 GGTCAGCGGCAAATGGAGGAGGG - Intergenic
1084888634 11:72225540-72225562 GGTGAGCAGGAGAGGGAGTCGGG + Intronic
1085449945 11:76625704-76625726 GGAGAGCTGCAGAGGAAGAGGGG + Intergenic
1085460083 11:76688331-76688353 GGTGAGCAGCAGAAGGTGGCAGG + Intergenic
1085495266 11:76963195-76963217 GGAAACTTGCAGAGGGAGGAGGG + Intronic
1085684158 11:78606387-78606409 GGGGAGCTGAGGTGGGAGGAAGG - Intergenic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1086353005 11:85962198-85962220 GTTGCGCTGAAGAGGGAGGAGGG - Intronic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1087990715 11:104743407-104743429 GATGAACTGGAGATGGAGGAAGG + Intergenic
1088274781 11:108073841-108073863 GATGAGCTGTGGAGGGAGGCAGG - Intronic
1088430200 11:109750393-109750415 TGTGAGCCGAAGAGGGAAGATGG + Intergenic
1088457851 11:110050911-110050933 GGAGAGATAGAGAGGGAGGAGGG - Intergenic
1088741332 11:112769772-112769794 GGTGGGCTGGAGAGGCAGGGAGG - Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089953168 11:122548225-122548247 GATGAGCAGCCTAGGGAGGAGGG - Intergenic
1089959697 11:122604881-122604903 AGTGAGCAGCAGAGTGAGTAGGG + Intergenic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090118823 11:124002924-124002946 GGTGAACTAAGGAGGGAGGAAGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090457782 11:126864864-126864886 GATGAGCTGCATGGGAAGGATGG - Intronic
1090593643 11:128297230-128297252 GGCTTTCTGCAGAGGGAGGAGGG + Intergenic
1090744915 11:129697626-129697648 GGGGGGCTGGAGTGGGAGGACGG + Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091257829 11:134206313-134206335 GGTCAGCCTCAGAGAGAGGATGG - Intronic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1202813435 11_KI270721v1_random:37085-37107 GATGCGCTGCAGAGGGAGAGGGG - Intergenic
1091448440 12:558168-558190 GGTGAGCCCCTCAGGGAGGACGG + Intronic
1091467473 12:697690-697712 GGTGGGCTGGAGCGAGAGGAAGG + Intergenic
1091616552 12:2054243-2054265 GGTGAGCGGCGGAGGAGGGAGGG - Intronic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1091893991 12:4085500-4085522 GGTGGTCTTCAGAGAGAGGATGG - Intergenic
1091983216 12:4883493-4883515 GGAGAGGTGCAGAGGAAGGATGG + Intergenic
1092028090 12:5259807-5259829 AGTGAGTAACAGAGGGAGGAGGG + Intergenic
1092260839 12:6952545-6952567 GGTGAGGGGCAGACGGAGGAAGG - Intronic
1092529389 12:9331908-9331930 GGAGAGGAGCAGAGGGAGGGAGG + Intergenic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1092753564 12:11741575-11741597 GGGGAGCTGCAGAGGCAATAGGG + Intronic
1092899335 12:13044222-13044244 GGTGACCTGCATAGGTAGGGTGG + Intergenic
1093428325 12:19054585-19054607 GGTAGGCTGAAGGGGGAGGATGG + Intergenic
1093726914 12:22523603-22523625 GGTGAGCTGCAGAGGAAGATTGG - Exonic
1095424433 12:42060446-42060468 GGTGGGATGAAGGGGGAGGAAGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1096743499 12:53711190-53711212 GGGGACCTGGAGAGGGAGGGGGG + Intronic
1097251166 12:57632905-57632927 GGCGCGCTCCAGAGGCAGGAGGG - Exonic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097282084 12:57851224-57851246 TGAGGGCTGCAGAGGGAGGGAGG + Intergenic
1097804650 12:63952139-63952161 AGTGAGGTGCAGAGTGGGGAGGG - Intronic
1097806185 12:63967335-63967357 GGGAGGCTGAAGAGGGAGGATGG + Intronic
1098365936 12:69703240-69703262 GGTGGAATGCAGAGGAAGGATGG + Intergenic
1098717504 12:73849878-73849900 TGTGAGCTACAGAGAGAAGATGG + Intergenic
1100399519 12:94216835-94216857 GGTGGGATGCAGAGGGAGCTGGG - Intronic
1100704946 12:97190381-97190403 GGGAAGCTGCACAGAGAGGAAGG - Intergenic
1100728534 12:97437114-97437136 GGTGAGGAGCAGAGACAGGAGGG - Intergenic
1100935503 12:99660843-99660865 GGTGGGATACAGAGGGAGGTAGG - Intronic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101114722 12:101520799-101520821 GGTGAGCTGTGGGGAGAGGAGGG + Intergenic
1101991503 12:109489391-109489413 TGAGAGCTGCAGAGGGAGCTAGG + Intronic
1102427528 12:112855827-112855849 GGTGAGGTGAAGAGCGAGCAGGG + Intronic
1102598734 12:114012856-114012878 GGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1103309370 12:119991970-119991992 GCTGACCTGCAGAGGAATGAAGG - Intronic
1103524885 12:121561031-121561053 GGTGGGCGGCGGAGGGAGGGAGG - Intronic
1103527603 12:121578629-121578651 GGTGGGGTGGTGAGGGAGGAGGG - Intronic
1103912967 12:124362289-124362311 GGTGACCTGCTGAGGGAAGCAGG + Exonic
1104097529 12:125571207-125571229 GCTAAGCTGCAGAGCCAGGATGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104450505 12:128864784-128864806 GGTGAGCTGGAGAAGGAGTGTGG + Intronic
1105450474 13:20494860-20494882 TGTGTGCTGCCCAGGGAGGAAGG - Intronic
1106693185 13:32141856-32141878 GGTGAGATGCAGAGGGTCCAGGG + Intronic
1107628793 13:42320520-42320542 GGTGAGAGACAGTGGGAGGAGGG - Exonic
1108095524 13:46896903-46896925 GGCGAGCCGCACAGGGAGGGAGG - Exonic
1108311737 13:49199123-49199145 GGGGAGCTGAGGTGGGAGGATGG - Intronic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108493385 13:51002476-51002498 GGAGACCTTCAGAGGGAGAACGG - Intergenic
1108525814 13:51285124-51285146 GGGAGGCTGCAGTGGGAGGAGGG - Intergenic
1108692659 13:52873269-52873291 GGTGAGGAGGAGAGGGAGAAGGG + Intergenic
1109615443 13:64828469-64828491 GGTGCTCTGCTGAGAGAGGAGGG - Intergenic
1110335659 13:74327330-74327352 GGAGAGCTGGAGAGGACGGATGG + Intergenic
1111541661 13:89675640-89675662 GGTAAGCTGCATAGGGAACATGG + Intergenic
1111790165 13:92845328-92845350 GGTCAGCTGCAGACCCAGGAAGG + Intronic
1112190712 13:97174896-97174918 TGTGAGCTGAAGTGGGAGAAAGG - Intergenic
1112956071 13:105059703-105059725 GGAGAGCTGGAAAGGGAGAAAGG - Intergenic
1112992030 13:105525618-105525640 GGTGAGCTCAAGAGGCAGGCAGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113440243 13:110322935-110322957 GGTCAGCTGGAGCGGGAGGGCGG + Intronic
1113523212 13:110954830-110954852 GGTGAGCTGCCCAGGGCGAAAGG + Intergenic
1113662392 13:112116600-112116622 GGAGAGCTGTAGAGGGACGGAGG + Intergenic
1113702149 13:112395979-112396001 GGTGAGCTGCCCAGGGCGAAAGG - Intronic
1113881261 13:113627935-113627957 GGGGAGCTCCTGGGGGAGGAGGG + Intronic
1114270323 14:21097174-21097196 GGTGAGCTGCAGAGTGGAGCGGG - Intronic
1114452413 14:22836153-22836175 TGAGACCTGCAGAGGGAGAAGGG - Intergenic
1115080934 14:29449961-29449983 GGAGAGGTGGGGAGGGAGGAAGG - Intergenic
1115306959 14:31943622-31943644 GGGGAGCTGAGGAGTGAGGATGG + Intergenic
1116934662 14:50726790-50726812 GGTGGACTGCAGAGGGATGGGGG - Intronic
1117088296 14:52223712-52223734 GGTGACTTGCAGAGGTGGGAGGG + Intergenic
1117754899 14:58964737-58964759 GGCGACAAGCAGAGGGAGGAGGG - Intergenic
1117770010 14:59124701-59124723 GGTGAGCTGAATTGGGAGCAAGG - Intergenic
1118570719 14:67192089-67192111 GCTGCGCTGCAGAGCGAGGGTGG - Intronic
1118752448 14:68816792-68816814 GGAGAGCGGCCGCGGGAGGACGG - Intergenic
1118759551 14:68871673-68871695 GCTGGGCTGCAGGGAGAGGAGGG + Intergenic
1118893891 14:69930227-69930249 GGAGAGGTGCAGAGGTGGGAAGG - Intronic
1119024921 14:71144922-71144944 GAAGAGCTGCATAGGGAGGGTGG - Intergenic
1119065124 14:71517985-71518007 GGCGAGCTGCAGTGGCTGGACGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119431489 14:74570812-74570834 GGTGAGCAGCAGGGTGGGGAAGG - Intronic
1119850080 14:77860928-77860950 GGAGAGCTGGGGAGGGAGGTGGG + Intronic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1119892553 14:78193903-78193925 GGTGAGGTACAGAGAGAGAAAGG - Intergenic
1119981456 14:79086290-79086312 GGTTAGAGGCAGAGGTAGGAAGG + Intronic
1120045363 14:79799666-79799688 GGTGGGCTGGAGAAGGAGAAGGG - Intronic
1121467643 14:94126352-94126374 GGAGAGCAACAGAGGCAGGAGGG - Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122047514 14:99034531-99034553 GGGGAGGGGCAGAGGGAGGGAGG - Intergenic
1122076183 14:99236449-99236471 GGTTTGCTACAGAGGGAAGATGG + Intronic
1122106541 14:99461121-99461143 GGTGTGCTGTAGAGGGCGCAGGG - Intronic
1122286542 14:100655789-100655811 GGAGAGCACCAGAGTGAGGAGGG - Intergenic
1122482617 14:102056878-102056900 GCTGAGCTGCAGCGGGAGTTGGG - Intergenic
1123051711 14:105547229-105547251 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123077125 14:105672932-105672954 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1123813685 15:23955080-23955102 GGAGGACTGCAGAGGGAGGCAGG + Intergenic
1124443686 15:29709180-29709202 GGTGTGATGCTGAGGGATGAGGG + Intronic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1125967270 15:43884530-43884552 AGAGAGCTGGGGAGGGAGGAAGG - Intronic
1126750615 15:51873136-51873158 GATGAGATGAAGAGAGAGGAAGG - Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1127903581 15:63359293-63359315 GGGGAGCTTTGGAGGGAGGAAGG - Intronic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1128072786 15:64807852-64807874 GGGAAGGTGCAGAGTGAGGATGG - Intergenic
1128429952 15:67582714-67582736 GGTGGGCTGAGGTGGGAGGATGG + Intronic
1128733030 15:70033806-70033828 GGTGGCATGCAGAGGCAGGAGGG + Intergenic
1129457861 15:75685259-75685281 GGAGCCCTGCAGAAGGAGGACGG - Exonic
1129725945 15:77901755-77901777 GGAGCCCTGCAGAAGGAGGATGG + Intergenic
1130059733 15:80560814-80560836 GCTGAGCTGCAGAGTAAGTAAGG - Intronic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130312482 15:82767451-82767473 GAGGAGCTGGAGAGGCAGGAAGG + Intronic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1130959810 15:88652351-88652373 GGTGAGGAGGAGGGGGAGGAGGG - Intronic
1131145140 15:90006083-90006105 GGTCTGCAGCAGAGGGAGGCTGG + Intronic
1131946278 15:97625634-97625656 AGTCAGCTGCAGATGGAGGTAGG + Intergenic
1132329824 15:101004499-101004521 GTTGAGCTGCAGAGGCAGCCAGG + Intronic
1132866837 16:2097297-2097319 GGTGAGCTGGGGTGAGAGGAGGG - Exonic
1132878997 16:2153007-2153029 CGTGTGGTGAAGAGGGAGGACGG + Exonic
1133263484 16:4568530-4568552 GGGTAGCTGCAGTGGAAGGATGG - Intronic
1133395294 16:5442304-5442326 GCGGAGCTGCAGAGGGAGCCAGG + Intergenic
1133555581 16:6903749-6903771 GGTGAGAGGCAGAGGGCTGAGGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1134047019 16:11108493-11108515 GGCTAGCTGCAGAGGGTGGGTGG - Intronic
1134430827 16:14204213-14204235 GGGAGGCTGAAGAGGGAGGATGG - Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134523785 16:14929832-14929854 GTTGAGCTGCAGATGCAGCACGG - Intronic
1134549117 16:15131103-15131125 GTTGAGCTGCAGATGCAGCACGG + Intronic
1134711376 16:16328317-16328339 GTTGAGCTGCAGATGCAGCACGG - Intergenic
1134719226 16:16371620-16371642 GTTGAGCTGCAGATGCAGCACGG - Intergenic
1134948200 16:18340265-18340287 GTTGAGCTGCAGATGCAGCACGG + Intergenic
1134955453 16:18380376-18380398 GTTGAGCTGCAGATGCAGCACGG + Intergenic
1135112354 16:19699990-19700012 GGGAGGCTGAAGAGGGAGGATGG + Intronic
1135725988 16:24854192-24854214 GGAGTGGGGCAGAGGGAGGAGGG - Intronic
1136577546 16:31133383-31133405 AGGGAGCTGCCCAGGGAGGAAGG + Exonic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137531253 16:49280386-49280408 GGTGAGGGGTAGAGAGAGGAGGG - Intronic
1137598816 16:49742639-49742661 GGTGGGCAGGGGAGGGAGGATGG + Intronic
1137955589 16:52825685-52825707 AATGAGTTGCAGAGGGAGGCAGG - Intergenic
1137984832 16:53099053-53099075 GGTGAGCAGCTGAGGGTGGGAGG + Intronic
1138095670 16:54209481-54209503 GGTGAGATGGAGAGAGAGGCTGG + Intergenic
1138774873 16:59709140-59709162 GGTGAGCAGCAGGGAGAGCAAGG - Intergenic
1139366893 16:66439079-66439101 GGACAGCTGCAGTGGGAGGTAGG + Intronic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1140279774 16:73543917-73543939 GGAGAGAGGCAGAGGGAGAAAGG + Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1140908488 16:79430109-79430131 GGAGAGCTGAAGCGGGAGGCTGG - Intergenic
1141185493 16:81784171-81784193 GGTGTGCAGTAGAGGGAGGTGGG + Intronic
1141390119 16:83657566-83657588 GGTCTGCTGCAGAGGAAGGTGGG - Intronic
1141450492 16:84097192-84097214 GGTGGGATGCAGAGTGAGAATGG + Intronic
1141475754 16:84272070-84272092 GAGGAGCTGGAGAGGGATGAAGG + Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142248690 16:88981244-88981266 GGTGAGCCACAGAGGGAGTGGGG + Intergenic
1142252643 16:88999706-88999728 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252656 16:88999730-88999752 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252674 16:88999769-88999791 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252700 16:88999824-88999846 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142350575 16:89577456-89577478 GGTGAGCGGCAGAGGGGAGATGG + Intronic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142597279 17:1035766-1035788 GGGGAGGGGCTGAGGGAGGATGG - Intronic
1143165523 17:4895504-4895526 GGTGAGTGGGGGAGGGAGGAGGG + Intronic
1143410317 17:6704555-6704577 GGTGAGCTGGGGAGGGAGCTTGG + Intronic
1143514778 17:7414167-7414189 GGCTAGCTGGGGAGGGAGGAGGG + Intronic
1143576891 17:7798959-7798981 GGGGTGCTGAAGTGGGAGGATGG + Intronic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1144645927 17:16973331-16973353 GGAGAGGTGGAGAGGAAGGAGGG + Intergenic
1144829742 17:18124519-18124541 CGTGAGCAGCACGGGGAGGATGG + Exonic
1146401400 17:32502887-32502909 GGACAGCTGCCGAGGGAGGCTGG + Intronic
1146907818 17:36629407-36629429 GGTGAGCTGCGGCGGCAGGCAGG + Intergenic
1146919220 17:36698735-36698757 AGTGAGATTCAGAGGGAGGTAGG + Intergenic
1147261568 17:39212176-39212198 GGAGAGGGACAGAGGGAGGAAGG + Exonic
1147498198 17:40937501-40937523 TGTGACCTGCAGAGGGACGATGG + Intronic
1147659214 17:42108229-42108251 TGTGAGCTCCAGAGGGAGGCCGG + Intronic
1147672956 17:42187345-42187367 GGGAAGCTGAAGGGGGAGGATGG - Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147911344 17:43858040-43858062 AGTAAACAGCAGAGGGAGGAGGG - Intronic
1148221239 17:45863884-45863906 AGTGTGCTGCAGAGTGGGGAGGG - Intergenic
1148347299 17:46912079-46912101 GGGAAGCTGCAGGGGGAGGATGG - Intergenic
1148461861 17:47843603-47843625 GAGGAGCTGCATGGGGAGGAGGG + Intergenic
1148469263 17:47883432-47883454 CGAGAGCTGCAAAGGGAGCAGGG - Intergenic
1148737549 17:49873292-49873314 GGTGGGATGCTGAGGGGGGAGGG + Intergenic
1148912605 17:50950894-50950916 GGTGACCTGCGGAGGGAGGAGGG - Intergenic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149321500 17:55486430-55486452 GGAGAGATGCAGATGGAGGTAGG - Intergenic
1150370241 17:64631228-64631250 GGTGGGGTGGAGAGGGAGGGAGG + Intronic
1150867435 17:68868222-68868244 TGGGAGCTGCAGAGGCAGCACGG - Intronic
1151436655 17:74101818-74101840 GGGGAGCTGCAGAGGAAGGGAGG - Intergenic
1151950386 17:77350259-77350281 TGTGGGCTGCACAGGAAGGAGGG - Intronic
1152013995 17:77737544-77737566 GGAGAGCCCCAGAGGGAGCAAGG + Intergenic
1152238767 17:79151415-79151437 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238783 17:79151453-79151475 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238799 17:79151491-79151513 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238814 17:79151526-79151548 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238829 17:79151561-79151583 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238845 17:79151599-79151621 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238860 17:79151634-79151656 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238877 17:79151672-79151694 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238892 17:79151707-79151729 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238907 17:79151742-79151764 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238922 17:79151780-79151802 GGGGACCTGCAAGGGGAGGAGGG + Intronic
1152238937 17:79151815-79151837 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238954 17:79151853-79151875 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238969 17:79151888-79151910 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152540060 17:80970324-80970346 GGTGGGCACCGGAGGGAGGATGG - Intergenic
1152667443 17:81579510-81579532 GGTCAGCTGAAGGGGGAGGCTGG - Intronic
1152803451 17:82342936-82342958 GGTGATCTGCGGAGGTGGGAGGG + Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1152853523 17:82650529-82650551 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1152979928 18:267604-267626 GGGGAGCTGCTGAAGGGGGAGGG - Intronic
1153028496 18:691983-692005 AGTGAACTGCAGAGGAAAGAAGG + Intronic
1153057263 18:958484-958506 GGTGAGTTTCACAGGGAGGGAGG + Intergenic
1153758056 18:8303068-8303090 GGTGATCTGTGGAGGGAGCAAGG + Intronic
1153924720 18:9825924-9825946 TGGGAGCTTCAGAGGCAGGAAGG + Intronic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1155761400 18:29572474-29572496 GGTGAACTGCAGAGGAAGGCTGG + Intergenic
1156445121 18:37230951-37230973 TGTGAGCTGCAGAGGGGAGAAGG - Intronic
1157131625 18:45012866-45012888 GGTGAGTGGGAGAGGGACGAGGG + Intronic
1158452622 18:57580726-57580748 GGTGGGGTGCAGTGGGAGGAGGG - Intronic
1158593289 18:58795354-58795376 GGGAAGCTGCAGTGGGAGGATGG - Intergenic
1158634936 18:59148162-59148184 GGTGATCTGCAGAGCCAGGTGGG - Intronic
1160352857 18:78199914-78199936 GATGACCTGCAGAGGATGGAAGG + Intergenic
1160378411 18:78430849-78430871 AGTGAGAGGCGGAGGGAGGAAGG - Intergenic
1160386402 18:78499628-78499650 GGAGTGGTGCAGACGGAGGACGG - Intergenic
1160389274 18:78518068-78518090 GGGGAGCCGCAGTGTGAGGATGG + Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160527102 18:79544483-79544505 GGTGAGGAGCAGAGAGGGGAAGG - Intergenic
1160730982 19:641676-641698 GGGGAGGTGCAGGGCGAGGAAGG + Intronic
1160948499 19:1654540-1654562 AGTGAGGTGGAGAGGGATGAGGG - Intergenic
1161156056 19:2732411-2732433 GGTGTGCGGCAGGGAGAGGAGGG + Intronic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161214196 19:3085130-3085152 GGGGAGCTGAGGAGGGAGGGAGG + Intergenic
1161303197 19:3552991-3553013 GGTCACCTCCGGAGGGAGGAAGG - Intronic
1161636216 19:5390892-5390914 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1161977931 19:7616391-7616413 GGGGTGCTGCAGAGGGCCGAGGG + Intronic
1162032887 19:7925042-7925064 GGTGAGATGCGCAGAGAGGAAGG + Exonic
1162152527 19:8656257-8656279 GGTGGGCTTCAGAGAGAAGATGG - Intergenic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162311905 19:9913103-9913125 AGTGGGGTGCAGCGGGAGGAGGG - Intronic
1162377080 19:10310968-10310990 GGTGAGTGGCAGAGTCAGGAAGG + Intronic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163378498 19:16948933-16948955 GGAGAGGAGCAGAGGGGGGAGGG + Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1163786174 19:19275972-19275994 ACTGTGCTGCAGAGGGAGGTTGG - Intergenic
1163797777 19:19347263-19347285 GGTGAGCTGGAATGGGAGGCGGG - Exonic
1164137355 19:22427249-22427271 AGTGGGCTGCGGAGGCAGGAAGG - Intronic
1164189323 19:22900583-22900605 GCTGGGCTCCAGAGAGAGGAAGG + Intergenic
1164482156 19:28620095-28620117 GGGCAGCTGCAGAGGGAGCTAGG + Intergenic
1164506319 19:28864132-28864154 TGTGAGCTGCCCAGGGACGAGGG - Intergenic
1164564898 19:29318750-29318772 GGTGAGCTGCGGGGGCAGGGAGG - Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165465889 19:35974574-35974596 GGGAAGCTGAGGAGGGAGGATGG - Intergenic
1165848705 19:38836253-38836275 GGTGGGCTGCAGACTGAGAATGG - Intronic
1166298834 19:41903020-41903042 GGGGAGCTGAGGTGGGAGGATGG - Intronic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1166994985 19:46716032-46716054 GGTGTGCGGAAGAGGGAGGAAGG - Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167317592 19:48774406-48774428 GGGGGGCTGAAGTGGGAGGAAGG - Intergenic
1167421141 19:49404118-49404140 GGTGAAGGGCAGAGGAAGGACGG - Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1168277928 19:55287329-55287351 GGTAACCTGGAGAGGGAGGATGG - Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925550205 2:5065535-5065557 AGTGATCTACACAGGGAGGAGGG - Intergenic
925705932 2:6684772-6684794 GGGAAGCTGGAGAGGGAGGAGGG + Intergenic
925817359 2:7767056-7767078 GGGGACCTGGAGAGGGACGACGG - Intergenic
926083945 2:10009702-10009724 GGAGAGAGGCAGAGGCAGGAAGG - Intergenic
927466802 2:23342892-23342914 GGTGGGCTGGAGAGCGAGGAAGG + Intergenic
927475286 2:23409926-23409948 GGTGAGCTGGGGAAGGAGCAGGG + Intronic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927724011 2:25406770-25406792 GGTGAGCTGCTGTGGAAAGAAGG + Intronic
927783203 2:25955383-25955405 GGTGAGCAACAGGGGGAGGCAGG - Intronic
927863185 2:26573233-26573255 AGTGAGCTCCAGAAGGAGGGAGG + Intronic
928094366 2:28394557-28394579 GGAGACCGGCAGAGGGAAGAGGG + Intronic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
928440477 2:31287958-31287980 GGTGAGCAGCAGGGGCTGGAAGG + Intergenic
928590446 2:32809371-32809393 CGTGAACTGCAGGGAGAGGATGG - Intronic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
931241074 2:60453017-60453039 GGAGAGCGGGAGAGGGAGGAGGG + Intronic
932337712 2:70940343-70940365 GGTGGGCTGGATAGGGAGGTGGG - Exonic
932578928 2:72980879-72980901 GGTGTAATGCAGAGGGAGGGAGG - Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
934564101 2:95328952-95328974 GGGGAGCTGCAGAGGAGGGGAGG + Intronic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
935750382 2:106227573-106227595 GGGAAGCTGAAGTGGGAGGATGG - Intergenic
935854771 2:107261981-107262003 GATGTGCTGCAGAGGAGGGAAGG + Intergenic
936072766 2:109382421-109382443 GGTGGGCTGCTGAGGGAGGTGGG - Intronic
936285454 2:111177926-111177948 GGTGAGATGAGGAAGGAGGAGGG - Intergenic
936469531 2:112786554-112786576 GGTGAGGTTCAGAGAGAGGTGGG + Intergenic
936812013 2:116413666-116413688 GGAAGGCTGCAGAGGGAGAAGGG - Intergenic
937225912 2:120368567-120368589 GGTGAGGGGAAGAGGGAGGAGGG + Intergenic
937271795 2:120657557-120657579 GGTGAGCAGGAGAGGGAAGCAGG - Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937815484 2:126245877-126245899 GGTGAGCCGCAGAAGAAGAAGGG - Intergenic
938016916 2:127874850-127874872 GGAGAGCTGCAGAGACAGAAAGG - Intronic
938104731 2:128521942-128521964 GGAGTGCTGCAGAGGGAGAAGGG + Intergenic
938422505 2:131155971-131155993 GGAGAGCTCCAGAGAGAGAAAGG + Intronic
938494112 2:131783258-131783280 GGTGAGTCGCAGAGGGAGACTGG + Intergenic
938696638 2:133840951-133840973 GGTCAGGCGCAGAGGGAGCAAGG + Intergenic
938727905 2:134122825-134122847 GGTGAACTGCAATGGCAGGAGGG + Intronic
940648983 2:156421884-156421906 GGTAGGCTGAAGAGGGAGGAAGG + Intergenic
941110845 2:161417460-161417482 GGTGAGCTGGAGTGGGAAGGTGG - Intronic
941540018 2:166770660-166770682 GGTAAGCTGCAGTGTGGGGAGGG - Intergenic
941784370 2:169481408-169481430 GGTCTGCTGCAGAGAGAGGTTGG + Intronic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
941939252 2:171016072-171016094 GGTGGGCTGGAGAGTGGGGATGG - Intronic
943305677 2:186258763-186258785 GGGAAGCTGAAGTGGGAGGATGG + Intergenic
943716284 2:191155556-191155578 GGTGAGCTGGAGTTGGAGGTTGG + Intergenic
945194889 2:207228583-207228605 GGTTTGCTGGAGTGGGAGGAGGG - Intergenic
945319139 2:208401597-208401619 GGTGTGCTGCAGAGGAAGAAGGG - Intronic
946154340 2:217797350-217797372 GGCCAGCTGCAGAGGGATGTAGG - Intergenic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
947859416 2:233348245-233348267 GGTGAACTGCAGGTGGAGGAGGG + Intergenic
947871975 2:233444324-233444346 GGTGAGCTGCAGATGGACAGAGG - Intronic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948575015 2:238944204-238944226 GCAGGGCTGCAGGGGGAGGAAGG + Intergenic
948770822 2:240250542-240250564 GGAGGGCTGAAGAGGGAGGAGGG + Intergenic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1169872165 20:10259641-10259663 GGGGAGCTGAAGTGGGAGGATGG - Intronic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1172427546 20:34865287-34865309 GCTGAGCTGAGGTGGGAGGATGG - Intronic
1172663087 20:36580703-36580725 GGGGGGCTGAAGTGGGAGGAAGG + Intronic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173285677 20:41669860-41669882 GGTGAGAGACAGAGGAAGGAAGG + Intergenic
1173733302 20:45343037-45343059 GGTGAGCAGCAGAGCTAGGACGG + Intronic
1173845635 20:46186700-46186722 GATGAGCTGAAGGGTGAGGAGGG + Exonic
1174104084 20:48149707-48149729 GGTGAACTGGAGAGGGAGGTGGG + Intergenic
1174118260 20:48242778-48242800 GGGGCGCTGCAGAGGGAGAGAGG - Intergenic
1175306192 20:57977226-57977248 GAAAAGCTGCAAAGGGAGGAGGG + Intergenic
1175961427 20:62638695-62638717 TGGGAGATGCAGAGGGAGGGCGG + Intergenic
1176049015 20:63106846-63106868 AGCGAGCTGCAGTGTGAGGATGG + Intergenic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1176613802 21:9011120-9011142 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1178345940 21:31828065-31828087 GGGAAGATGCAGAGGAAGGAAGG + Intergenic
1178428469 21:32498481-32498503 GGTGAGCAGTTGAGGGAGAAAGG + Intronic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179410480 21:41159305-41159327 GGTGTGGTGCAGAGGTAGGATGG + Intergenic
1179501198 21:41810057-41810079 GGGGGTCTGCAGAGGGAGGTGGG + Intronic
1179966142 21:44807176-44807198 GCTGAGCTGCAGTGAGGGGACGG - Intronic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1180159181 21:45991433-45991455 GGTGAGCGGGGGCGGGAGGAGGG + Intronic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180630954 22:17229597-17229619 AGTGAGCAGCTGAGGGATGATGG - Intergenic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180872059 22:19151743-19151765 GGAGGTCTGCTGAGGGAGGAGGG - Intergenic
1181371956 22:22425825-22425847 GGTGAGCAGCAGAGGGATTCAGG - Intergenic
1181403758 22:22667504-22667526 TGTGAGCTCCAGAGGGTGGGTGG - Intergenic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1182550570 22:31098840-31098862 GGTGAGCTGCAGAAGTGGGCTGG + Exonic
1182692445 22:32173531-32173553 TGTGAGCAGCAGAGAGAGAATGG - Intergenic
1182756899 22:32687653-32687675 GGTGAGCTCAAGAGGGAGGCGGG - Intronic
1182987242 22:34731882-34731904 GGTGAGCTGCAGCCAGTGGAGGG + Intergenic
1183056698 22:35311127-35311149 GGTGAGTGGGAGTGGGAGGAAGG + Intronic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183240228 22:36652366-36652388 GGAGGGCTGCAGAGGTAGGCAGG - Intronic
1183329629 22:37212365-37212387 GGAGAGATGCAGAGAGAGGCAGG + Intergenic
1183371275 22:37433801-37433823 GGAGAGCTGGAGGAGGAGGAAGG + Intergenic
1183414640 22:37675387-37675409 GGGGAGGTGGAGAGGGATGAAGG + Intergenic
1183673554 22:39287350-39287372 GAGGAGCTGCAGACGGAGCAGGG + Intergenic
1183686305 22:39363186-39363208 GGGGAGCTTCAGAGGAAGGCAGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184124153 22:42475238-42475260 GGTGAGGCTCAGAGGGAGGCTGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184507675 22:44914101-44914123 GGTGAGGGGCACAGGGAGGAAGG + Intronic
1185100951 22:48840586-48840608 AGTGGGGTGTAGAGGGAGGAGGG - Intronic
1185109208 22:48891526-48891548 GGGGAGCTGCAAACGGAAGAGGG + Intergenic
1185335302 22:50268603-50268625 GGTCACCTGCAAAGGGAGGGTGG - Intronic
1185399964 22:50610599-50610621 GGATGGCTGCAGAGGGAGGAAGG + Intronic
1185410267 22:50678088-50678110 GGTGAGCTGGAGAGGAAGATGGG + Intergenic
949184053 3:1169060-1169082 AGTGAGTGGCAGAGGAAGGATGG + Intronic
949405056 3:3705444-3705466 GGAGAGGGGCAAAGGGAGGAAGG + Intronic
949999816 3:9648475-9648497 TGTGAGCAGCAGGGGGAGAAAGG + Intergenic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950158393 3:10740999-10741021 GCTGAGCAGCAGCGGTAGGAAGG - Intergenic
950420072 3:12893093-12893115 GGTGAGATGCAGGGGCAGGGGGG - Intergenic
950543503 3:13625864-13625886 GGTGTGCTGCAGGGGAGGGAAGG - Intronic
951269091 3:20603191-20603213 GGTGAGGTGCAGAGGAGGCAAGG + Intergenic
952307111 3:32156053-32156075 GGTGAGTTGCCGAGTCAGGATGG - Intronic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952364443 3:32662564-32662586 GGGAAGCTGAAGTGGGAGGATGG + Intergenic
952458513 3:33499184-33499206 GGAGAGCTGCAGAGCGAAGCGGG - Intronic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953210152 3:40868471-40868493 GGGTAGCTGCAGAGGGAGAATGG - Intergenic
953369426 3:42374911-42374933 GGGGAGCTGAGGTGGGAGGATGG - Intergenic
953569163 3:44057736-44057758 GATGACCTCGAGAGGGAGGAAGG - Intergenic
953928470 3:46994292-46994314 AGTGGGCTGCAGAGGGATGGGGG - Intronic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954278031 3:49554856-49554878 GGTGAGCTGCAGCCTGAGGCCGG + Intronic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
955083943 3:55683878-55683900 GGGGAGGTGCACAGAGAGGAGGG + Intronic
955396765 3:58563097-58563119 GGTGTATTGCAGAGGGAGAAGGG + Intergenic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
955972627 3:64450932-64450954 GGTGAGCTGGAGAGAGTGGTTGG - Intergenic
956008535 3:64805951-64805973 GGTCAGTTACAGAAGGAGGAAGG - Intergenic
956378907 3:68645125-68645147 CCTGAGCTGCAGGGGGAGTAAGG - Intergenic
956468672 3:69542720-69542742 GGGGAGGGGGAGAGGGAGGAAGG + Intergenic
956776373 3:72568630-72568652 GACAAGCAGCAGAGGGAGGAAGG - Intergenic
959041014 3:101423708-101423730 GCTAGGCTGAAGAGGGAGGAAGG + Intronic
959896521 3:111612900-111612922 GGTGGGCTACAGATGCAGGAGGG - Intronic
960446508 3:117756077-117756099 TTTGAGCTGAAGAGGAAGGATGG - Intergenic
960639925 3:119814866-119814888 GGCGAGAGGAAGAGGGAGGATGG - Intronic
960975492 3:123169836-123169858 GTTGACCGGCAGAGGGAGGGAGG + Intronic
961066362 3:123880585-123880607 GGAGAGGAGCAGAGGGTGGAAGG + Intronic
961512112 3:127409516-127409538 GATGAGCTGGGGAGGGAGGTAGG - Intergenic
961714192 3:128847562-128847584 AGTGAGCTGGGCAGGGAGGAAGG + Intergenic
961987927 3:131157698-131157720 GCTGGGCTGAAGGGGGAGGAAGG + Intronic
962374929 3:134851458-134851480 GGGGAGTTGCAGGGGAAGGAGGG - Intronic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963399791 3:144783592-144783614 GGTTAGCTGAAGTAGGAGGAGGG + Intergenic
964786282 3:160399891-160399913 GGGGAGCGGCCGAGGGGGGAGGG - Intronic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
966978064 3:185103897-185103919 GGGAACCTGCACAGGGAGGAGGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
967934504 3:194716119-194716141 AGTGAGCTCCACAGGCAGGAGGG - Intergenic
968289233 3:197525906-197525928 AGAGACCTGCAGAGGGAGCACGG - Intronic
968563286 4:1296103-1296125 GGTGAGGTGCAGATGTAGGTGGG - Intronic
968563343 4:1296304-1296326 GGTGAGGTGCAGATGTAGGTGGG - Intronic
968573199 4:1353247-1353269 GGTGGCCTGCAGAGGCAGGCAGG - Exonic
968657881 4:1786468-1786490 GCTGAGCTGGAGTGGCAGGAGGG + Intergenic
968889247 4:3359087-3359109 GGTGAGGAGGAGAGGGAGGAGGG - Intronic
968944644 4:3657269-3657291 GGGGAGCGGGAGAGGGAAGAGGG - Intergenic
969035975 4:4254311-4254333 GGTGAGTTCCACAGGGATGACGG - Intergenic
969210830 4:5685776-5685798 GGTGCGCTGCACAGTGAGAAAGG - Intronic
969365133 4:6689910-6689932 GATGGGCTGGAGGGGGAGGAGGG - Intergenic
969399296 4:6943325-6943347 GGAGAGGGGCAGAGGGAGGAAGG - Intronic
969682094 4:8649032-8649054 GGTGAGCGGCACAGGGAACATGG - Intergenic
969694050 4:8725003-8725025 GGTGAGCTTCAGCATGAGGAGGG - Intergenic
970505839 4:16729485-16729507 AGAGAGCAGGAGAGGGAGGAGGG + Intronic
971325313 4:25638670-25638692 TGTGAGGGGCAGAGGGGGGAAGG + Intergenic
973239548 4:47942650-47942672 GGTGAGCTGCAGGGTGAGGGAGG + Intronic
973758109 4:54094651-54094673 GGAGAACTGGAGAGGGAGGGAGG + Intronic
974397643 4:61359449-61359471 GGGCGGCTGCAGAGGGAGGGAGG - Intronic
974603770 4:64122699-64122721 GGGAAGCTGCAGTGAGAGGAGGG + Intergenic
975252150 4:72192873-72192895 GGTGGGGTGGAGAGGGAAGAAGG + Intergenic
977213310 4:94246606-94246628 GGTGGGCCTCAGAGTGAGGATGG + Intronic
979140995 4:117174480-117174502 GGGGCGTTGCAGAGGGTGGAAGG + Intergenic
980347826 4:131645542-131645564 GATGAGCTGCCTAGGGAAGAAGG - Intergenic
980495822 4:133586841-133586863 GAGTAGCTGCATAGGGAGGATGG - Intergenic
981550436 4:145937147-145937169 GGGGAGCTGGAGAGGGAGTGGGG + Intronic
982371950 4:154643175-154643197 GGTGACATGCAGAGAAAGGAGGG + Intronic
982764908 4:159335198-159335220 GGTGATGTGCATAGAGAGGAAGG + Intronic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983775705 4:171604689-171604711 GGGGAGCGGAGGAGGGAGGAAGG - Intergenic
984775754 4:183480466-183480488 GGGAAGCTGAAGAGGGAGGATGG + Intergenic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
984959850 4:185086187-185086209 AGGGAGCTGCAGATGGCGGAGGG + Intergenic
985530899 5:433373-433395 GGTGACCTGGAGAGTGGGGAGGG - Intronic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
986009215 5:3697061-3697083 GGTGAGGTGCAGCGGGCGGGTGG + Intergenic
986192209 5:5508151-5508173 GGGGAACTGCAGAGGGAAGAGGG - Intergenic
986272547 5:6246457-6246479 GGTGAGCTGCTGAGTGAGGGAGG + Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986687092 5:10284135-10284157 CGTGAGCTGCAGAGCGTGGCCGG - Intronic
986795101 5:11202628-11202650 GGGAGGCTGCAGGGGGAGGAGGG - Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987244714 5:16037251-16037273 GGTGAGCAGCAGGGGAGGGAGGG - Intergenic
987395585 5:17420024-17420046 GATGAGCTGCTGAGAGAGGCTGG - Intergenic
988052157 5:26044274-26044296 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
989451029 5:41586962-41586984 GGAGAAGTGCAGAGGGAGAAGGG + Intergenic
990474128 5:56145045-56145067 GGTGAGCTGCATGGAGAAGATGG + Intronic
990884844 5:60579639-60579661 GGTGAGCTGCAGCTGGTGGCTGG - Intergenic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991258418 5:64640544-64640566 AGGAAGCTGAAGAGGGAGGATGG + Intergenic
992436901 5:76763177-76763199 CATGAGCTGCAGAGGGGAGAAGG - Intergenic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
994043162 5:95281223-95281245 GATGAGCTGCTGAGAGAGTAAGG + Intronic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
994970465 5:106730736-106730758 GGGAGGCTGCAGTGGGAGGAGGG - Intergenic
995478887 5:112575876-112575898 GGTGAGGGACAGAGGGAGAAGGG - Intergenic
995499561 5:112789962-112789984 GGGAAGCTGAGGAGGGAGGATGG - Intronic
995747179 5:115416124-115416146 GGGGAGCTGTAGAGAGAGGTGGG + Intergenic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
996209731 5:120793045-120793067 GGTTAGCTGAGGTGGGAGGATGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996874121 5:128222710-128222732 GGTGAGCAGGAAAGGGAGAATGG - Intergenic
996900631 5:128538434-128538456 GGTGAGGGGAAGAGGAAGGAAGG + Intronic
996903059 5:128565928-128565950 GGTGAGCAGCTTAGGTAGGATGG - Intronic
997349160 5:133217850-133217872 GATCAGCCGCCGAGGGAGGATGG - Intronic
997437449 5:133885502-133885524 GGGGAGCTGACGGGGGAGGAGGG + Intergenic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
997999090 5:138610059-138610081 AGTGAGCTGGAGAGGGAGTGTGG - Intergenic
998012868 5:138709325-138709347 GGTGAGCGGCAGGAGGAGGCTGG - Intronic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
998504844 5:142664134-142664156 GATGAGCCCCAGGGGGAGGAAGG + Intronic
998656389 5:144185162-144185184 GCTGAGCAGTAGAGTGAGGATGG + Intronic
998797988 5:145839186-145839208 ACTGAGCTGCAGGGGCAGGAAGG - Intergenic
999471466 5:151858583-151858605 GGTGGGCTCCTGAGCGAGGAAGG + Intronic
999566819 5:152873114-152873136 TGTGTGCTTCAGAGTGAGGATGG - Intergenic
999656470 5:153815511-153815533 GGAGAGGGGAAGAGGGAGGAAGG + Intergenic
999760225 5:154694359-154694381 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
999869483 5:155734307-155734329 GGAAGGCTGCAGTGGGAGGATGG - Intergenic
1000799785 5:165711767-165711789 GGTGAGTAGCACATGGAGGATGG - Intergenic
1000867507 5:166533314-166533336 AGTGAGGTGCAGGGGTAGGAGGG - Intergenic
1001016851 5:168149658-168149680 GGTGAGGAACAGAGAGAGGATGG - Intronic
1001421322 5:171589428-171589450 TGTGAGAAGCAGAGGTAGGAGGG + Intergenic
1001902294 5:175442614-175442636 GCTGAGCTGCACTGGGATGAAGG + Exonic
1002022323 5:176371746-176371768 GGGGAGCTGCAGCGGGAGCTGGG + Exonic
1002329200 5:178429876-178429898 GGAGTGGTGCAGAGGGAGGTGGG - Intronic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003114665 6:3275967-3275989 GGTGACCTGGGCAGGGAGGATGG + Intronic
1003308096 6:4946823-4946845 GGTCAGTGCCAGAGGGAGGAGGG - Intronic
1003418160 6:5931761-5931783 GGTGGGCAGGAGAGGGAGAAGGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003751928 6:9068640-9068662 TGTGAGATGCAGGGGGATGATGG - Intergenic
1003792922 6:9567162-9567184 GGAAAGCTGCCCAGGGAGGATGG + Intergenic
1004002805 6:11610891-11610913 GGTGAGGTGAGGAAGGAGGAGGG + Intergenic
1004473292 6:15947931-15947953 GGGGAGCTCCAGAGGAAAGACGG + Intergenic
1004722023 6:18276030-18276052 GAAGAGGTGAAGAGGGAGGAGGG - Intergenic
1004902348 6:20206039-20206061 GGTCAGCAGTGGAGGGAGGAAGG - Intronic
1005913046 6:30327199-30327221 GGTGAGCAGCAGCGGGACGGGGG - Intronic
1005949705 6:30622706-30622728 GGAGAGCTGTAGAGGGGTGAAGG + Intronic
1006162452 6:32046453-32046475 GGAGCTGTGCAGAGGGAGGAGGG + Intronic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006366868 6:33621244-33621266 GGCGAGCTGCGGGGGGAGGGGGG + Exonic
1006597326 6:35203049-35203071 GGGAAGCAACAGAGGGAGGAAGG + Intergenic
1006813598 6:36836717-36836739 GGAGAGGAGCACAGGGAGGAGGG - Intronic
1007307903 6:40921488-40921510 AGAGCCCTGCAGAGGGAGGAAGG + Intergenic
1007400295 6:41599238-41599260 GGAGAGCTGGTGGGGGAGGAGGG - Exonic
1007659596 6:43475643-43475665 GATGAGCTGCGGAGGGGAGAGGG + Intergenic
1007762327 6:44140284-44140306 GGTGAGCAGCAGATACAGGAAGG - Exonic
1008036264 6:46748775-46748797 GGAGAGCTGAGGAGGGAGTAAGG - Intronic
1008936670 6:56999644-56999666 GCTTAGCTGCAGGGGAAGGAGGG - Intronic
1011410622 6:87062429-87062451 GGAAAGCTGCAGTGGGAGGATGG - Intergenic
1012780802 6:103554863-103554885 GGTAAGCCCCAGAAGGAGGAGGG - Intergenic
1012795002 6:103748708-103748730 GGGGAGCTGGAGTGGGAAGATGG - Intergenic
1013147275 6:107406350-107406372 AGTGAGCTGTAGAGTAAGGAAGG - Intronic
1013394638 6:109722929-109722951 TGGGAGCTGGAGAGAGAGGAAGG + Intronic
1015973507 6:138766676-138766698 GGTCAGAGGCAGAGGGAGAAAGG - Intronic
1016312123 6:142745538-142745560 TGTGATTGGCAGAGGGAGGAGGG + Intergenic
1016861372 6:148721912-148721934 GGAGACCTGGAGAGGGAGCAGGG - Intergenic
1017670754 6:156767203-156767225 GGTGGGCTGAAGCAGGAGGAGGG - Intergenic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018272352 6:162093840-162093862 GGTGAGGTGCAGAGGAAACAAGG - Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018471356 6:164101154-164101176 GGTGGCCTGCAGGTGGAGGAGGG - Intergenic
1018471362 6:164101175-164101197 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471369 6:164101195-164101217 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471385 6:164101236-164101258 GGTGGCCTGCAGGTGGAGGAGGG - Intergenic
1018471391 6:164101257-164101279 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471462 6:164101444-164101466 GGGGACCTGCAGGTGGAGGAGGG - Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1019122124 6:169811926-169811948 AGTGGGTTGGAGAGGGAGGAAGG - Intergenic
1019138703 6:169929439-169929461 GGTGAGGTTAAAAGGGAGGATGG + Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019443861 7:1060935-1060957 GCTGGGCTGCAGGGGTAGGAGGG - Intronic
1019666097 7:2252938-2252960 GGGGAGCAGAAGAGGGATGAGGG - Exonic
1019706437 7:2499280-2499302 GCTGAGCCGCAGAGGAGGGATGG + Intergenic
1019750988 7:2729635-2729657 GGTGAGCTGCAGAGGGGCTCGGG + Exonic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1019927806 7:4204803-4204825 GGAGAGCCCCAGTGGGAGGAGGG + Intronic
1020002529 7:4764033-4764055 GGAGAGCTGCAGAGGGACCCAGG + Exonic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020121294 7:5505209-5505231 GGTGTGCTGCCTGGGGAGGAGGG - Intronic
1022111621 7:27235777-27235799 GGCGTGTTGCAGCGGGAGGAGGG - Intergenic
1022184971 7:27958508-27958530 TGTGTGCTGCAGAGGGAACATGG + Intronic
1022963265 7:35450436-35450458 GGAGAATTGCAGAGGAAGGAAGG - Intergenic
1023607050 7:41940676-41940698 GGTGGGCTGCTGTGGGAGCAGGG + Intergenic
1024301762 7:47892375-47892397 AGTGAGCTGTGGAGGCAGGAAGG + Intronic
1025014015 7:55424297-55424319 GGTCAGCTGCAGAGACAGGCAGG - Intronic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025998782 7:66545171-66545193 GGCTGGCTGCAGAGGGAGGGAGG - Intergenic
1026306860 7:69150023-69150045 GGAGGGTTGGAGAGGGAGGAGGG - Intergenic
1026683525 7:72488786-72488808 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
1028637196 7:93002783-93002805 GGTGAGTAGCAAAGGGAGGATGG + Intergenic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029869942 7:103680198-103680220 GGTGAGAAGGAGAGGGAGGAGGG + Intronic
1030079848 7:105767854-105767876 GGTGGACTGGAGAAGGAGGAAGG - Intronic
1030149961 7:106394444-106394466 GGACAGTTGTAGAGGGAGGAGGG - Intergenic
1030301057 7:107975487-107975509 TGTGAGATTTAGAGGGAGGAAGG - Intronic
1032075483 7:128833880-128833902 GGGGAGCTGCTGGGGAAGGAAGG + Intronic
1032121965 7:129162937-129162959 GGTGTGACCCAGAGGGAGGAAGG + Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032715651 7:134506969-134506991 GGTGGACTGCAGAGGGAAGCTGG + Intergenic
1032917849 7:136511661-136511683 GAGGAGCTGGAGAGGGAGGCTGG + Intergenic
1033039859 7:137908271-137908293 GGGGAGCTGGAGAGGGCGGAGGG + Exonic
1033323468 7:140360850-140360872 TGTGAGCTTCAGAGGGAGATGGG - Intronic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1034252913 7:149706622-149706644 GGAGAGGAGGAGAGGGAGGAGGG - Intergenic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034455028 7:151165382-151165404 GATGAGCTGAAGAGAGAGGATGG - Intronic
1034865138 7:154635278-154635300 GGTGAGCTGAAGTGGGTGGTGGG - Intronic
1034881210 7:154763999-154764021 GGTGTGGTGCAGATGGAGGTGGG - Intronic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035603403 8:912704-912726 GGTCAGCTCCACAGAGAGGAAGG - Intergenic
1035908795 8:3542909-3542931 GGAGAGCTGCCTGGGGAGGACGG - Intronic
1036434296 8:8718996-8719018 GTTGAGGTTCAGAGGAAGGAGGG - Intergenic
1036798681 8:11773693-11773715 GGTGAGTTGATGAGGCAGGAGGG + Intronic
1037743203 8:21623425-21623447 GGTGAGCTGAGGTGGGAGGTGGG - Intergenic
1037806081 8:22058559-22058581 GGTGGGCTAGAGAGGCAGGAGGG + Intronic
1037806436 8:22060162-22060184 GGCGAGCTGCAGCAGGAAGAGGG - Intronic
1037818147 8:22122620-22122642 GGTGGGCAGGAGAGGGAGGTTGG + Intronic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037933664 8:22899673-22899695 GGTGAGGAGGAGAGAGAGGAGGG + Intronic
1038045914 8:23765481-23765503 TGTGAGCTGCCGAGGAAAGAAGG + Intergenic
1038261173 8:25996188-25996210 GGAAGGCTGCAGTGGGAGGATGG + Intronic
1038761118 8:30384785-30384807 GGCGACCTGGAGAGGGAGGGCGG - Exonic
1039043115 8:33426701-33426723 GGAGAGCTGGGGAGGGAGGTAGG - Intronic
1039064727 8:33598670-33598692 GTTGAGCTGCAGAGCTGGGAAGG + Intronic
1041552001 8:59113565-59113587 GGTAAGCTGAAGAGGGAGCCAGG + Intronic
1041829073 8:62132424-62132446 GCTGAGCTGCAGTTAGAGGATGG + Intergenic
1042052868 8:64730971-64730993 GGAGAAGTGCAGAGTGAGGAGGG - Intronic
1042207174 8:66340978-66341000 GATATGCTGCAGAGGGAGGAAGG - Intergenic
1042228875 8:66537160-66537182 GGTCAGCTCCTGAGGGAGGGAGG + Intergenic
1043285999 8:78532365-78532387 GGTGAGCTGGAGTGGGATGAGGG - Intronic
1043531046 8:81150243-81150265 GGTAAGCTGGAGGAGGAGGAAGG + Intergenic
1044266575 8:90188888-90188910 GGGGGGCTGAAGCGGGAGGATGG + Intergenic
1044776466 8:95693878-95693900 GGCGGACTGCAGAGGGAGGAGGG - Intergenic
1045650623 8:104338843-104338865 CGTGAACTGGAGTGGGAGGAGGG - Intronic
1045732920 8:105263127-105263149 GGTGTGCTGCATTGTGAGGAGGG + Intronic
1045872247 8:106940063-106940085 GGTGCCCTGTGGAGGGAGGATGG - Intergenic
1048054990 8:130854847-130854869 AGTGACCTACAGAGGGAGGGAGG - Intronic
1048065721 8:130966428-130966450 GGTTAGGTGCAGAGGGAAGAAGG + Intronic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1048981903 8:139706837-139706859 GGTGACCTGAGGAGGGAGGCGGG + Intergenic
1049036598 8:140081155-140081177 AGTGTGCTGCTGAGGAAGGAGGG - Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049516151 8:143057957-143057979 AGAGAGATGCAGAGGGAGGGAGG - Intronic
1049683664 8:143930748-143930770 GGTGAGCTGGGGTGAGAGGAGGG - Intronic
1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG + Intronic
1049707695 8:144050522-144050544 GGTGGTCTGCAGAGAGAGGCGGG - Intergenic
1049782484 8:144435295-144435317 GCTGGGCTGCAGGGAGAGGAGGG - Intronic
1049958778 9:718415-718437 GGGAAGCTGAAGAGGGAGGATGG - Intronic
1050123261 9:2330328-2330350 GGTGAGATGGAGGGGGTGGAGGG - Intergenic
1050204017 9:3178607-3178629 GGGAAGCTGAGGAGGGAGGATGG + Intergenic
1051116367 9:13698388-13698410 GCTGAGCTGAAGGGGGAAGAAGG - Intergenic
1052407012 9:28073786-28073808 GGGGAGCTGAAGTAGGAGGATGG + Intronic
1053089917 9:35265696-35265718 GGGAGGCTGCAGCGGGAGGATGG + Intronic
1053328606 9:37181922-37181944 GGGAAGCTGAAGTGGGAGGATGG - Intronic
1053543071 9:38994334-38994356 GTTGGGCTGAAGGGGGAGGAAGG - Intergenic
1053648378 9:40138460-40138482 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1053757360 9:41325381-41325403 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054329356 9:63736403-63736425 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1054536202 9:66237710-66237732 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1056776568 9:89517184-89517206 GGGAAGCTGCAGTGGGAGGATGG - Intergenic
1056780382 9:89544602-89544624 TGTGATCTGGAGAGGGAGGCAGG - Intergenic
1056796295 9:89660949-89660971 GGTGACCTCCAGAGGGAGAAGGG + Intergenic
1057165591 9:92922856-92922878 GGTGAACTGCAGAGGGGTTAAGG - Intergenic
1057294435 9:93827148-93827170 GGTGAGGTGCTGAGGGAGGCGGG + Intergenic
1057418467 9:94887241-94887263 GGGGAGCTGAGGTGGGAGGATGG + Intronic
1057928217 9:99171182-99171204 GCTGAGCCCCAGGGGGAGGAAGG - Intergenic
1057932882 9:99211724-99211746 GGGGAGCTGCTGAGGTAGTAGGG + Intergenic
1057976526 9:99611070-99611092 GGTGAGCAGCACAGGGCGGCAGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1059443674 9:114325032-114325054 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1059444874 9:114331809-114331831 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1059719108 9:116942250-116942272 GGTTAGCTGCAGTTGGAGGAGGG - Intronic
1059822944 9:117994229-117994251 GGAGAGCTGGAGAGGAAGGAGGG - Intergenic
1059993916 9:119891234-119891256 GAAGGGCTGCAGAGAGAGGACGG - Intergenic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1060468678 9:123929975-123929997 GGAGAGCGCCAGAGGGAGGCCGG - Exonic
1061152331 9:128835975-128835997 GGTGAGTTGCTGAGGGTGGGAGG - Exonic
1061367647 9:130180924-130180946 GGTGAGTTGGGGAGGGAGAAGGG + Intronic
1061857189 9:133448803-133448825 GGTGACCTGCGGAGGGGGGCAGG + Intronic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1185764555 X:2715111-2715133 GAAGAGCTGCAGAAGAAGGAAGG - Intronic
1185779008 X:2829448-2829470 GGAGAGGTGCAGAGCGTGGAGGG + Intronic
1186415914 X:9382800-9382822 GGAGGGCTGAAGAGGGAGGCAGG - Intergenic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1187031311 X:15491287-15491309 GCTGAGCTGTAGAGGATGGAGGG + Exonic
1188384160 X:29535027-29535049 GGGAAGCTGAAGTGGGAGGATGG + Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1188820764 X:34771893-34771915 GGAGAGCTGAGAAGGGAGGAGGG + Intergenic
1190220743 X:48511048-48511070 GGGGAGCTGGAGAGGGTGGCAGG - Intronic
1190448602 X:50555849-50555871 GGTGACCTGCAAAGGGGGTAGGG + Intergenic
1190472343 X:50795517-50795539 GGTGAGCACCAGATGGAAGATGG + Intronic
1191675187 X:63785449-63785471 GGTGGGGTGCAGGGAGAGGATGG + Intronic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192264711 X:69530441-69530463 GGTGTGCTGAAGTGGCAGGAGGG - Exonic
1192371892 X:70521108-70521130 GGTGAGCTGCTGAAGCAGGGCGG - Intergenic
1195321884 X:103727504-103727526 GGTGAGCTGAACAGGAAAGATGG - Intronic
1195702049 X:107712929-107712951 GCGGAGCAGGAGAGGGAGGAAGG + Intergenic
1195706348 X:107740651-107740673 GGTGTACAACAGAGGGAGGATGG + Intronic
1195888127 X:109662780-109662802 GGAGAGGTGAAGAGTGAGGAAGG + Intronic
1196645848 X:118116812-118116834 GGGGGGCTGCTGAGGGAGGGGGG + Intronic
1196982686 X:121232282-121232304 GGGAAGCTGCAGTGTGAGGAGGG + Intergenic
1197773598 X:130106205-130106227 GGTCAGCAGCAGCTGGAGGAGGG - Intronic
1197782479 X:130171845-130171867 GGTGCGCTGGAGGAGGAGGAGGG + Exonic
1198224844 X:134635692-134635714 GGTGAGGTGCAGTGAGGGGATGG - Intronic
1198724527 X:139663610-139663632 GGTCAGCTTGAGTGGGAGGATGG - Intronic
1198809176 X:140518147-140518169 AGTGAGATCCAGAGAGAGGAAGG - Intergenic
1199680500 X:150221252-150221274 GATGCGGTGCAGAGAGAGGAGGG - Intergenic
1199851537 X:151727554-151727576 GGCAAGCTTCAGTGGGAGGAAGG + Intergenic
1200788276 Y:7277489-7277511 GGGAAGTTGCAGTGGGAGGATGG + Intergenic
1201741493 Y:17328598-17328620 GGTGATAGGCAGAGGTAGGATGG + Intergenic
1201857715 Y:18563909-18563931 GCAGAGGTGCAGAGGAAGGAGGG + Intronic
1201875606 Y:18756472-18756494 GCAGAGGTGCAGAGGAAGGAGGG - Intronic