ID: 1029676186

View in Genome Browser
Species Human (GRCh38)
Location 7:102070588-102070610
Sequence CTTTGGGTACGGAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029676177_1029676186 24 Left 1029676177 7:102070541-102070563 CCAAGAAACCAGGGAGTGCAGGA 0: 1
1: 0
2: 3
3: 16
4: 265
Right 1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG 0: 1
1: 0
2: 2
3: 19
4: 190
1029676172_1029676186 28 Left 1029676172 7:102070537-102070559 CCCCCCAAGAAACCAGGGAGTGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG 0: 1
1: 0
2: 2
3: 19
4: 190
1029676174_1029676186 26 Left 1029676174 7:102070539-102070561 CCCCAAGAAACCAGGGAGTGCAG 0: 1
1: 0
2: 4
3: 47
4: 299
Right 1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG 0: 1
1: 0
2: 2
3: 19
4: 190
1029676173_1029676186 27 Left 1029676173 7:102070538-102070560 CCCCCAAGAAACCAGGGAGTGCA 0: 1
1: 0
2: 3
3: 22
4: 219
Right 1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG 0: 1
1: 0
2: 2
3: 19
4: 190
1029676178_1029676186 16 Left 1029676178 7:102070549-102070571 CCAGGGAGTGCAGGACACATGAA 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG 0: 1
1: 0
2: 2
3: 19
4: 190
1029676175_1029676186 25 Left 1029676175 7:102070540-102070562 CCCAAGAAACCAGGGAGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG 0: 1
1: 0
2: 2
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029676186 Original CRISPR CTTTGGGTACGGAGGGAAAT TGG Intronic
901946993 1:12712134-12712156 CCTTAGGTATGGAGGGAATTGGG + Intergenic
903517142 1:23918975-23918997 CTTTTGGTGCTGCGGGAAATGGG + Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
907923286 1:58932774-58932796 ATTTGGGCGTGGAGGGAAATGGG + Intergenic
908490838 1:64642704-64642726 CTTTGAATACTGAGGGCAATGGG - Intronic
911460396 1:98181991-98182013 CCTTTGGTATGGAGGAAAATGGG - Intergenic
912509434 1:110178517-110178539 CTTTGGGAAGGGAAGGGAATGGG - Intronic
912517853 1:110227165-110227187 GTTTGGGGACAGAGGGAAGTGGG - Intronic
915492878 1:156261226-156261248 CTTGGGGTAAGGAGGTTAATGGG - Intronic
920008472 1:202850710-202850732 CTATGGGGACTGAGGGAAAGGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1069465602 10:68636073-68636095 ATTTGAATAAGGAGGGAAATTGG + Intronic
1070119732 10:73564319-73564341 CTTTTGGTACGGTATGAAATAGG + Intronic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1071283555 10:84124539-84124561 TCTTAGGTACGGAGGGGAATGGG + Intergenic
1071331938 10:84569381-84569403 CATTGGGTATGGAGGGGCATGGG + Intergenic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1073782747 10:106857275-106857297 TTTTGGGTAGGGAAGGAGATGGG - Intronic
1075622653 10:123939249-123939271 CTTCGGGTAAGGCTGGAAATAGG + Intronic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1080528521 11:33151085-33151107 CTTAGGGATTGGAGGGAAATGGG - Intronic
1082771151 11:57208597-57208619 CTCTGGGTAAGGAGGCAGATTGG + Intergenic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085668573 11:78439704-78439726 CTTTTGGTATGGAAGGAGATAGG - Intronic
1089569245 11:119392148-119392170 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1090753207 11:129765420-129765442 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1095431013 12:42134605-42134627 GTCTGAGTAGGGAGGGAAATGGG - Intronic
1095680917 12:44974473-44974495 CTTTGGGTACTCGGGGAAAAGGG - Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096239730 12:49953425-49953447 CCTTGGGTAAGGAGAGAACTCGG - Intronic
1096420472 12:51452893-51452915 CTTTGGGGAAGGAGCGAGATGGG + Intronic
1097245423 12:57605106-57605128 CTTTGGCTACTGAGGGATGTGGG + Intronic
1098524584 12:71471984-71472006 CTTTGGGGACTCAGGGAAAAGGG + Intronic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100706778 12:97209389-97209411 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1102183742 12:110932115-110932137 CTTTGGGGAAGAAGGGACATTGG + Intergenic
1102605762 12:114066146-114066168 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1103563832 12:121805592-121805614 CTCTGGGTTCGGAAGGAAAGGGG - Intronic
1104135827 12:125937325-125937347 CTTTGGGTACTTAGGGGAAAGGG - Intergenic
1104160684 12:126177325-126177347 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1104469114 12:129014837-129014859 CTTTGGCTGCAGAGGGAATTTGG + Intergenic
1105202702 13:18193665-18193687 GTTTGGGTAAGGGGGAAAATTGG + Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1109945825 13:69430246-69430268 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110182263 13:72631770-72631792 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110532290 13:76611210-76611232 GCTTGGGCACAGAGGGAAATAGG - Intergenic
1111115373 13:83769643-83769665 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111893169 13:94108364-94108386 CTTTGGGGACTCAGGGAAAAAGG + Intronic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1115568930 14:34649037-34649059 CTTTAGGTTTGGAGGGAATTGGG + Intergenic
1115886192 14:37974554-37974576 CTTTGGGTAATGTGGGGAATAGG + Intronic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1121440307 14:93944699-93944721 CTTGGGGGACAGAGGGAAATGGG + Intronic
1122393717 14:101407965-101407987 CTGGGGGTACAGAGAGAAATTGG - Intergenic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127226464 15:56935633-56935655 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1127807375 15:62533759-62533781 CTTTGGCTAAGGAGAGAAGTTGG + Intronic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1130144519 15:81263746-81263768 CTTTGGGTTCAGAGGGAATGAGG - Intronic
1131792822 15:95983519-95983541 CTTTGGATGTGGAGGCAAATGGG + Intergenic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1138059318 16:53873130-53873152 CTTTGATTATGGAGGGAAAGAGG + Intronic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138631996 16:58303890-58303912 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144418005 17:15069934-15069956 CTTTGGGTATAGTGGGGAATAGG - Intergenic
1145095973 17:20026883-20026905 CTGTGGGTAGGGATGCAAATTGG - Intronic
1151201816 17:72474136-72474158 CTTTGGGGACGCGGGGAAAAGGG + Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1154015131 18:10609435-10609457 CTTTGGGGTCTGAGGGCAATGGG + Intergenic
1154348762 18:13565755-13565777 CTTTGTGTGTGGAGGGGAATTGG + Intronic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1156534384 18:37848696-37848718 CTCTGGGTAATGAGGGTAATAGG + Intergenic
1157135808 18:45054153-45054175 CTTTTGGTAAGGAGTGAATTGGG - Intronic
1157144478 18:45147759-45147781 CTTTGGGGACTCAGGGAAAGGGG - Intergenic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1159564146 18:70029140-70029162 CTTTGGCTAGGGAGGAAAAGAGG + Intronic
1162439551 19:10683933-10683955 CTATGGGTACGGAGGCAACTCGG + Exonic
1165662814 19:37597212-37597234 GTTTGGGTACTGAGGGAGAAGGG + Intronic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1168360141 19:55732619-55732641 CTTTGGCTGCAGAGGGAATTTGG - Exonic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925665705 2:6252988-6253010 CTTTGGGGACTCAGGGAAACGGG - Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931809756 2:65843395-65843417 CTTTGGGCCAGTAGGGAAATGGG + Intergenic
932021281 2:68089765-68089787 CTTTTGGTACAGAGGTGAATGGG - Intronic
933390085 2:81656903-81656925 TCTTAGGTACAGAGGGAAATGGG + Intergenic
933493962 2:83024479-83024501 GTTTGCGTATGGGGGGAAATGGG + Intergenic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
938677843 2:133656929-133656951 CTTTGGGTACTCAGGGGAAAGGG - Intergenic
939729779 2:145768436-145768458 CTTTTGTTAAGGAGGGGAATTGG - Intergenic
940132942 2:150405090-150405112 CTTTGGGTACACAGAGATATTGG + Intergenic
942458806 2:176155638-176155660 CTTAGGGCAGGGAAGGAAATGGG + Intronic
943526409 2:189021971-189021993 ATTAGGTTAAGGAGGGAAATGGG + Intergenic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
944675673 2:202033245-202033267 CTTTGGGTCCGGGGGGAAAGAGG + Intergenic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
945307014 2:208268036-208268058 CTTTGGGTAGGTAGGTTAATAGG + Intronic
947556604 2:231098918-231098940 TCTTAGGTACAGAGGGAAATGGG + Intronic
1168823554 20:793488-793510 TCTTAGGTACGGAGGGAAATAGG - Intergenic
1173573537 20:44094624-44094646 CTTGGGGGATGGAGGGATATTGG - Intergenic
1174217336 20:48926778-48926800 CTTTGGGTACAGCAGGCAATGGG + Intronic
1175025584 20:55899006-55899028 CTTAGGAGAGGGAGGGAAATGGG + Intergenic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1184371745 22:44086815-44086837 CTCTGAGTACGGATGGAAGTTGG + Intronic
950846746 3:16022557-16022579 TGTTAGGTACAGAGGGAAATGGG + Intergenic
950868927 3:16212507-16212529 CTTTAAGAACGGCGGGAAATAGG - Intronic
952083357 3:29787670-29787692 CTTTGGGGACTCAGGGAAAAAGG + Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
956012103 3:64842893-64842915 CTTTGGCTACAGTGGCAAATAGG - Intergenic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
959043690 3:101448065-101448087 TTTTGGGTATGGAATGAAATAGG - Intronic
961582244 3:127892357-127892379 CCTTAGGTACGGAGGGAAATGGG - Intergenic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
966220943 3:177550472-177550494 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
967549106 3:190768556-190768578 CTTGGGGGACAGGGGGAAATGGG - Intergenic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970970014 4:21971525-21971547 CTTTGGGTATGGTGGGAGCTGGG + Intergenic
971921751 4:32949524-32949546 CTTTGGGGACTCAGGGAAATGGG + Intergenic
973556129 4:52084964-52084986 ATTTGGCTACGGGGGCAAATGGG - Exonic
975068021 4:70094237-70094259 CATTGGGGAGGGAGGGATATGGG - Intergenic
976217889 4:82731819-82731841 CTCTGGGGACGGAAGGGAATGGG - Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
978974705 4:114855444-114855466 TTTTGTGTACGGAGAGAGATAGG + Intronic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
980569731 4:134598675-134598697 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
980586383 4:134821948-134821970 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
986259485 5:6131782-6131804 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
987077895 5:14401533-14401555 GTTTGGAGACGGAGGGAAAGAGG + Intronic
987561938 5:19535343-19535365 CTTTGTGTGCTAAGGGAAATTGG + Intronic
988979715 5:36554591-36554613 CTTGGAGTTTGGAGGGAAATTGG - Intergenic
989615669 5:43334855-43334877 TCTTAGGTACAGAGGGAAATGGG + Intergenic
990112844 5:52349273-52349295 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
990777873 5:59323759-59323781 CTTTGGCTGCTGTGGGAAATTGG - Intronic
998212898 5:140214737-140214759 CTTTGGGTAGTAAGGGAAATTGG + Intronic
999207405 5:149859467-149859489 CTTGGGGAAGGGAAGGAAATAGG + Exonic
999362468 5:150997637-150997659 CTTTGGAAATTGAGGGAAATTGG - Intergenic
1003252249 6:4440304-4440326 CTTTGGGGACTCAGGGAAAAAGG - Intergenic
1003960022 6:11200146-11200168 CTTTGGGTAAGGGGGAACATTGG + Intronic
1004016237 6:11734525-11734547 ATTTGGGTACTCAGGGAAAGAGG + Intronic
1009979934 6:70715891-70715913 CTTTGGGGACTGGGGGAAAAGGG - Intronic
1010020323 6:71152210-71152232 CTTGGAGCACGGAGGGAGATAGG + Intergenic
1010390030 6:75326332-75326354 CTTTGGGGACTCAGGGAAGTGGG + Intronic
1011868852 6:91866958-91866980 CTTTGGTCAGTGAGGGAAATGGG + Intergenic
1012183221 6:96181585-96181607 CTTTGGGTACTCAGGGAGAAAGG - Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1014419920 6:121230945-121230967 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1014931027 6:127336463-127336485 CTTTGGGAAAGCAGGGAAATAGG - Intronic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1020635383 7:10690611-10690633 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1020732304 7:11895944-11895966 CTTCCGGTAAGGAGGGAACTTGG + Intergenic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1023585553 7:41726130-41726152 CTTTGGGAAGGGAGGGCATTTGG - Intergenic
1023798312 7:43811883-43811905 CCTTAGATACGGAGGGAAATGGG - Intergenic
1023798798 7:43815189-43815211 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1031089990 7:117342886-117342908 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1033098146 7:138448601-138448623 TCTTAGGTACAGAGGGAAATGGG + Intergenic
1035785105 8:2253788-2253810 CTTTGGATACTAAGTGAAATGGG - Intergenic
1035807706 8:2467928-2467950 CTTTGGATACTAAGTGAAATGGG + Intergenic
1036086209 8:5615907-5615929 CTTTGGGAACTGAAAGAAATAGG - Intergenic
1036105017 8:5829424-5829446 CTTTAGGTGCAGAGGGAAATGGG + Intergenic
1037402366 8:18505890-18505912 CTTGGGTTACAGAGAGAAATGGG + Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1043691621 8:83160474-83160496 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1050441550 9:5669290-5669312 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1050522769 9:6518759-6518781 TCTTGGGTACGGAGGGGAATGGG - Intergenic
1050715306 9:8517821-8517843 GTTTGGTTGAGGAGGGAAATAGG - Intronic
1052219535 9:26002637-26002659 CTTTGGGGACTTAGGGAAAAGGG + Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1055178457 9:73351347-73351369 CTGTGGGTAGGAAGGTAAATTGG - Intergenic
1057930831 9:99191499-99191521 CTTTTGGTGCGGAAGGTAATTGG - Intergenic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058428337 9:104895785-104895807 CTCAGGCTAGGGAGGGAAATGGG - Intronic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1060732517 9:126047683-126047705 CTATGGGTGCGGAGGGGTATTGG - Intergenic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1187445217 X:19355196-19355218 CTTTGGGTGGTGAGGGAAAGCGG - Intronic
1189331809 X:40148770-40148792 CATTGGCAAAGGAGGGAAATGGG + Intronic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1190731686 X:53230801-53230823 CTTTGGGTCCTCAGAGAAATGGG + Intergenic
1190963969 X:55280243-55280265 CTTTGGCTTCTGAGGGAAAGGGG + Intronic
1191148518 X:57194742-57194764 CTTTGGGTACTGAGTGGAAGGGG - Intergenic
1191629187 X:63302735-63302757 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1193007005 X:76631179-76631201 CTTTGGGTACTCTGGGAAAAGGG - Intergenic
1193088012 X:77464888-77464910 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
1194104128 X:89747347-89747369 CTTTGGGGACTGAGGGGAAAGGG - Intergenic
1194232369 X:91340319-91340341 CTTTGGGGACTCAGGGGAATGGG + Intergenic
1199637451 X:149826864-149826886 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1199910056 X:152276913-152276935 CTTTGAGGAGGGAGGGAAACAGG + Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic