ID: 1029676672

View in Genome Browser
Species Human (GRCh38)
Location 7:102074608-102074630
Sequence CAGTGGGAGTGGCGGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029676672_1029676682 14 Left 1029676672 7:102074608-102074630 CCAAATTCCCGCCACTCCCACTG 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1029676682 7:102074645-102074667 GAGTTCACCAAGGGTTGCACTGG 0: 1
1: 0
2: 0
3: 7
4: 86
1029676672_1029676681 5 Left 1029676672 7:102074608-102074630 CCAAATTCCCGCCACTCCCACTG 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1029676681 7:102074636-102074658 TCAGCAGCGGAGTTCACCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 70
1029676672_1029676680 4 Left 1029676672 7:102074608-102074630 CCAAATTCCCGCCACTCCCACTG 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1029676680 7:102074635-102074657 CTCAGCAGCGGAGTTCACCAAGG No data
1029676672_1029676676 -8 Left 1029676672 7:102074608-102074630 CCAAATTCCCGCCACTCCCACTG 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1029676676 7:102074623-102074645 TCCCACTGAGTCCTCAGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029676672 Original CRISPR CAGTGGGAGTGGCGGGAATT TGG (reversed) Intronic
901067799 1:6502687-6502709 GAGTGTGACTGTCGGGAATTGGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902714282 1:18261757-18261779 CAGAGGAAGTGGAGGGACTTGGG + Intronic
904810320 1:33159605-33159627 CAGTGGGAGTGGAGGCAGATGGG - Intronic
905026687 1:34855356-34855378 TAGTGGGAATGGCTGGGATTTGG - Exonic
905787925 1:40772595-40772617 CAGTGGGTGAGGTGGAAATTGGG + Intergenic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910688406 1:89941182-89941204 TAGTGGGAGAGGCAGGAATTGGG + Intergenic
911866878 1:103038412-103038434 CAGTGGCAGTGGCGCGATCTTGG - Intronic
912030671 1:105239425-105239447 CACTGGGAGTGATGGTAATTGGG + Intergenic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914956216 1:152165028-152165050 AAGTGGGAGTGGAGGAAATGGGG + Intergenic
915248566 1:154572631-154572653 CAGTAGGAGTGGTGTGTATTGGG + Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
920231764 1:204475426-204475448 CAGTGGAAATGATGGGAATTTGG - Intronic
1063282437 10:4645131-4645153 CTGTGGGTGTGGCAGGAATTGGG - Intergenic
1064992268 10:21266531-21266553 CAGTGTGGGTGTGGGGAATTGGG - Intergenic
1065374731 10:25027303-25027325 GAGTGGCAGTGGCGCGATTTCGG - Intronic
1065612986 10:27490950-27490972 CAATGGGACTGGCAGGAATGAGG + Intergenic
1067695966 10:48535920-48535942 CAGGTGGAGGGGCGGGAATTGGG + Intronic
1069714581 10:70512495-70512517 CAGTGGCAGTGGTTAGAATTAGG + Intronic
1070567194 10:77612913-77612935 CAGTGGGGGTGGGGGGAGTAGGG - Intronic
1072114431 10:92356226-92356248 CAGTGTGAATGTCAGGAATTTGG + Intergenic
1072578855 10:96722786-96722808 GAATGGGAGTGGCGGGGATAGGG + Intergenic
1073187752 10:101626897-101626919 CTGTGGGAGTGGCAGGGATGAGG + Intronic
1073444973 10:103575163-103575185 GAGAGGGAGGGGCGGGAAGTGGG - Intronic
1076533411 10:131160403-131160425 CAGAGGGAGTGGCGGGGTGTAGG - Intronic
1076533425 10:131160445-131160467 CAGAGGGAGTGGCGGGGTGTAGG - Intronic
1077045858 11:544863-544885 TGGTGGGAGTGGGGGGACTTGGG + Intronic
1077322817 11:1949875-1949897 CAGTGGCAGGGGCGGGAACGGGG + Intronic
1078190990 11:9092066-9092088 AGGTGGGAGTGGAAGGAATTGGG + Intronic
1080124090 11:28710882-28710904 GAGTGGGATTGGCGGGCTTTAGG + Intergenic
1082205253 11:49425689-49425711 CAGTGAAAGTGAGGGGAATTGGG + Intergenic
1082775411 11:57240912-57240934 CATTGAGAGGGGAGGGAATTGGG + Intergenic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084424151 11:69075432-69075454 CAGTGGGAGTTTGGGGAATAAGG + Intronic
1086649848 11:89274847-89274869 CAGTGAAAGTGAGGGGAATTGGG - Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088469190 11:110175987-110176009 CAGTGGGAGAGGCGGGAGTGGGG + Intronic
1089607776 11:119651647-119651669 CAGTGGGAGTGGGGGGATTGGGG - Intronic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1202805835 11_KI270721v1_random:5188-5210 CAGTGGCAGGGGCGGGAACGGGG + Intergenic
1091944969 12:4531534-4531556 CTGAGGGAGTGGCGTAAATTAGG - Intronic
1091965693 12:4739588-4739610 CAGTGGCAGAGGTGGGAGTTAGG + Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092982037 12:13805882-13805904 CATTGGGAGTTGAAGGAATTGGG - Intronic
1097733183 12:63151896-63151918 CAGCGGGGATGGCGGAAATTTGG + Intergenic
1098323745 12:69278860-69278882 AAGTGAGAGTGGGGGGAATGGGG - Intergenic
1101401002 12:104386643-104386665 GGGTGGGACTGGCGGGTATTAGG + Intergenic
1101523047 12:105502669-105502691 CCGTGGGAGTGGCAGGAAATGGG + Intergenic
1102972260 12:117178581-117178603 GAGGGGGAGTGGCAGGAATTGGG - Intronic
1104322304 12:127763033-127763055 GAGTGGGAGTGGGGGTATTTAGG + Intergenic
1104893947 12:132152861-132152883 CAGTGTGACTGGGGGGAGTTTGG + Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1111466245 13:88615009-88615031 GAGTTGGGGTGGCGGGAATGGGG + Intergenic
1113395109 13:109940222-109940244 CACAGGGAGTGGGGAGAATTGGG + Intergenic
1114499888 14:23160863-23160885 TAGTGGGAGTGGAGGGAGTTAGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1116839173 14:49802006-49802028 CAGTGGCAGTGGCGTGATCTAGG + Intronic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1119859485 14:77925937-77925959 CAGTGGCAGTGACGGGAGCTTGG - Exonic
1121102353 14:91258624-91258646 GAGTGGGAGTGCAGGGAACTTGG + Intergenic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1122135048 14:99627969-99627991 CAGTGGGAGGGGCGGCTGTTAGG + Intergenic
1123691097 15:22838778-22838800 CAGTGGGAGATGCGAGCATTCGG - Exonic
1124115094 15:26833943-26833965 GAGTGGGAGAGAGGGGAATTTGG - Intronic
1124257204 15:28153872-28153894 CGGTGGGAGGGGCGGGAATCAGG + Intronic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1126425038 15:48518271-48518293 CAGTCTTAGTGGTGGGAATTTGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1128377877 15:67090125-67090147 CACTGGGAGTGGCTGGAGTCGGG + Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129609247 15:77039826-77039848 CTGTGAGAGTGGTTGGAATTAGG - Intergenic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130335576 15:82954346-82954368 CAGTGGCAGTGGCGTGATCTCGG + Intronic
1131533714 15:93216299-93216321 CAGTGGGGGTGACAGGCATTTGG - Intergenic
1133259509 16:4538873-4538895 CAGTGGGAGCGGAGGCGATTTGG + Intergenic
1133984925 16:10661176-10661198 CAGGCGGAGGGGCGGGGATTTGG + Intronic
1138688245 16:58745376-58745398 CAGTGGGGGTGGCGGGGTTGGGG + Intergenic
1142686062 17:1577508-1577530 CAGGGGCTGTTGCGGGAATTGGG + Intronic
1143316009 17:6033963-6033985 TGGTGGTAGTGGAGGGAATTGGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144150395 17:12437648-12437670 CAGTGGGGGTGGGGGAAATGGGG - Intergenic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1146931845 17:36783230-36783252 CAGTGGGAATGCCTGGAATTTGG - Intergenic
1151691223 17:75686772-75686794 CAGTGGGGGTGGCTGGCATCTGG + Intronic
1151903948 17:77035698-77035720 CAGTGGGAGTGGGGGAAGTCAGG - Intergenic
1153482825 18:5564751-5564773 CAGTAGGAGTGGGAGGAGTTGGG - Intronic
1154161592 18:11984299-11984321 CAGTGTGGGTGGCTGGAACTAGG - Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1156903028 18:42323334-42323356 CAGTGTGAGAGGCAGGAATAAGG + Intergenic
1157688754 18:49664088-49664110 CACTGTGAGTGGCTGGAAGTAGG - Intergenic
1160465058 18:79069378-79069400 AAGTGGGAGGGGCGGGAAAGGGG + Exonic
1160530721 18:79560729-79560751 CACTGGGAGTGGCGGGGGTTAGG + Intergenic
1160836297 19:1126343-1126365 CGGTGGGGCTGGCGGGCATTGGG + Intronic
1161277985 19:3429610-3429632 CAGGGGGACTGGCGGGGGTTTGG + Intronic
1161793430 19:6373802-6373824 CTGTGGGAGGGGCGGGACCTGGG + Intronic
1163898215 19:20078193-20078215 AAGTGGCTGTGGCGGGACTTAGG + Intronic
1163933968 19:20424712-20424734 AAGTGGCAGTGGCGGGACTCAGG - Intergenic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166292500 19:41872050-41872072 GAGTGGCAGTGGCAGGAAGTCGG + Exonic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1167726413 19:51216075-51216097 CAGTGGGTGTGGGGAGACTTTGG - Intergenic
925226360 2:2186620-2186642 TAGAGGGAGTGGCGGGACATGGG - Intronic
926738146 2:16090026-16090048 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738165 2:16090122-16090144 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738184 2:16090218-16090240 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738203 2:16090314-16090336 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738223 2:16090410-16090432 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
927633276 2:24793018-24793040 GAGTGGGTGCGGCGGGAGTTGGG - Intronic
928910610 2:36417054-36417076 CAATGGGAGTGGCGGGATTCTGG - Intronic
929732965 2:44515299-44515321 CAGTGGGACTGGGAGGAGTTAGG + Intronic
932434094 2:71693008-71693030 CAGTGGCAGGGGCAGGACTTGGG - Intergenic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
933682433 2:85114093-85114115 CAGTGGGATTGATGGTAATTGGG - Intergenic
934728216 2:96638587-96638609 CGGTGGGGGTGGCGAGAACTGGG - Intronic
940481700 2:154240966-154240988 CAGTGGGAGGAGGCGGAATTTGG - Intronic
941099983 2:161284801-161284823 CAGTGGGAGTGGAAAGGATTAGG - Intergenic
942977264 2:182033010-182033032 CAATTGGAGTGGAGTGAATTTGG - Intronic
946272232 2:218603930-218603952 CAGTGGCAATGGCGTGAACTTGG + Intergenic
947783634 2:232794046-232794068 CAGTGAGAGGAGCAGGAATTTGG + Intronic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
949025132 2:241764177-241764199 CTGTGGGAGGGGCGGGGACTGGG + Intronic
1169892190 20:10465329-10465351 AAGTGGGAGTGGCTGGATTCCGG - Intronic
1169893484 20:10477947-10477969 GAGTGGGAGTGGCGTGATCTTGG + Intronic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1174371633 20:50092981-50093003 CAGTTGGAGTGGGGGGCCTTGGG - Intronic
1174399112 20:50266453-50266475 CAGTGGCAGTGGCGCGATCTCGG - Intergenic
1174949250 20:55026676-55026698 CAGGGGGAGGGGAGGTAATTTGG - Intergenic
1175598691 20:60255582-60255604 CAGTGGCAGCAGCTGGAATTAGG + Intergenic
1175905745 20:62378537-62378559 CAGTGGGAATGGCGGGATTTCGG - Intergenic
1177799072 21:25809568-25809590 CAGTGGCAGTTGTGGGGATTGGG + Intergenic
1178924194 21:36761529-36761551 CAGTGGGAGAGGGGTGGATTTGG + Intronic
1179043967 21:37829127-37829149 AAGTGGGAGTGGCGGGAGGTGGG + Intronic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182243449 22:28935836-28935858 TAGTGGGATGGTCGGGAATTCGG - Intronic
1182744341 22:32594130-32594152 CAGTGGGAGACAAGGGAATTGGG + Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183159787 22:36104668-36104690 AAGTGGGAGTTGAGGGCATTTGG - Intergenic
1185083012 22:48720146-48720168 CAGTGGGTGTGGCGGGGCTGGGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950631603 3:14285680-14285702 CAGTGGGGGTGGGGGGATTGAGG - Intergenic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954626262 3:52023600-52023622 CTCGGGGAGTGGCAGGAATTGGG + Intergenic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
955041105 3:55318655-55318677 CAGTGGTGGTGGTTGGAATTAGG - Intergenic
955041981 3:55326652-55326674 CAGTGGTAGTGGTTGGGATTAGG - Intergenic
962422903 3:135243734-135243756 AAGTTGGAGTGCCGGTAATTAGG + Intronic
963117174 3:141739971-141739993 CAGTGGCAGTGGCAGGAACAAGG - Intronic
968480387 4:830554-830576 CAGTGGGTGGTGCTGGAATTTGG + Intergenic
969418269 4:7075000-7075022 CAGTAGGAGTGGGGGAATTTGGG - Intergenic
970526108 4:16933878-16933900 AAGGGGGGGTGGCGGGAATTTGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
977260537 4:94791836-94791858 ACGTGGGAGTGGGAGGAATTAGG - Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
978895803 4:113885921-113885943 CAGTGGCAGTGGTGTGATTTCGG + Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
984764938 4:183393368-183393390 CAGTGGCAGTGGCGTGATCTCGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987704939 5:21450779-21450801 CATTGGGAGGAGGGGGAATTAGG - Intergenic
989184163 5:38606736-38606758 CAGTGGGACAGGCATGAATTTGG - Intronic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992746779 5:79828087-79828109 GAAGGGGAGTGGCGGGATTTGGG + Intergenic
993246443 5:85458925-85458947 CAGTGGTAGTGGCGGCAAAGGGG + Intergenic
993492553 5:88569779-88569801 GTGTGGGAGTGGCAGGAATGTGG - Intergenic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
995250178 5:109984202-109984224 CAGGGGTAGTGGTGGGAAATGGG + Intergenic
1001981091 5:176037452-176037474 CAGGGGGAGTGGGGAGAGTTGGG + Intergenic
1002236369 5:177806614-177806636 CAGGGGGAGTGGGGAGAGTTGGG - Intergenic
1002304833 5:178277007-178277029 TAGTGTGAGGGGCTGGAATTGGG + Intronic
1002528176 5:179826958-179826980 CAGAGTGAGTGGCAGGATTTAGG - Intronic
1007834311 6:44663039-44663061 CCGTTGGAATGGCAGGAATTTGG - Intergenic
1008131570 6:47725301-47725323 CAGAGGAAGTTGTGGGAATTGGG - Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1010141819 6:72621875-72621897 GAGTGGTAGTCGCGGGAATGAGG + Exonic
1013084129 6:106841036-106841058 CGGGGGGAGTGGGGGCAATTGGG + Intergenic
1013318505 6:108963988-108964010 CTCTGGGAGTGGTGGGTATTGGG + Intronic
1014320056 6:119916304-119916326 CAGTGGGATAGGTAGGAATTGGG - Intergenic
1016120894 6:140340066-140340088 AAGTGGGAGTCCTGGGAATTGGG + Intergenic
1018802817 6:167236562-167236584 CAGTGTGTGAGGCAGGAATTTGG + Intergenic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019103640 6:169651067-169651089 CACTGGGAGGGGTGGGAGTTGGG + Intronic
1019515576 7:1438470-1438492 CAGTGGGCGTGTGGGGCATTAGG - Intronic
1019752348 7:2739268-2739290 CAGTGGGAGTGGCGGCTGATAGG - Intronic
1023779381 7:43641979-43642001 CAGGGGCAGGGGAGGGAATTGGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024993545 7:55254594-55254616 CCGTGGGAGTGGAGGGCACTGGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1027695381 7:81404161-81404183 CAATGGGGGTTGCAGGAATTGGG + Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030495111 7:110289041-110289063 AAGTGGGAGTTGGGGGAGTTGGG - Intergenic
1032197238 7:129796477-129796499 GAGTGGGAGGGGCTGGAGTTTGG - Intergenic
1033638550 7:143237699-143237721 CAGTGGTAGTGGTGGGCACTGGG + Intergenic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1040392171 8:46959639-46959661 CAGTGTGATTGCAGGGAATTTGG + Intergenic
1042233634 8:66585683-66585705 CAGTGGCAGTGGCGCGATCTCGG - Intronic
1044799925 8:95943688-95943710 CAATGGGAGTGGCAGAAAATGGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045583285 8:103501077-103501099 CAGGGAGAGAGGCGGGAATATGG - Intronic
1046272010 8:111909114-111909136 CAGAGGCAATGGTGGGAATTGGG - Intergenic
1046770611 8:118112896-118112918 CACTGGGAGTGGCAGGAGCTTGG - Intergenic
1047806249 8:128363591-128363613 CTCTGGGAGTTGTGGGAATTAGG + Intergenic
1049214919 8:141403075-141403097 CGGAGGGAGTGACGGGACTTAGG + Intronic
1049618587 8:143587782-143587804 CAGTGGGAGTGGCACGAGGTGGG - Intronic
1051906200 9:22097272-22097294 TAGAGGAAGTGGCAGGAATTTGG + Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1056581916 9:87894774-87894796 CACCGGGAGTGGGGGGAAATTGG + Intergenic
1057374741 9:94510361-94510383 CAGTGCAAGTGGCGTGATTTCGG + Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1061028442 9:128065667-128065689 CAGTGGGGGTTGGGGGAGTTGGG - Intronic
1062461177 9:136663157-136663179 CAGCGGGAGTGAGGGGAATGGGG - Intronic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1186317191 X:8383831-8383853 CAGTGGCAGTGGCTGGATGTTGG + Intergenic
1189281338 X:39821719-39821741 CGGTGGTGGTGGCGGGGATTGGG - Intergenic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1195824464 X:108982964-108982986 TAGTGGGTGTGGGGTGAATTGGG - Intergenic
1196503316 X:116411137-116411159 CAGTTGGAGTGGCTGGGATGCGG - Intergenic
1197201776 X:123754656-123754678 CAGTGGCAGTGGCGTGATCTCGG + Intergenic
1197648638 X:129042238-129042260 CAGTGGGAGTGGTGGAGATGGGG + Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1200748690 Y:6925057-6925079 CACTGGAAGTGGCTGAAATTGGG - Intronic
1201351372 Y:13045889-13045911 CAGTGGCAGTGGCGTGATCTCGG - Intergenic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic