ID: 1029677177

View in Genome Browser
Species Human (GRCh38)
Location 7:102078122-102078144
Sequence GGTACCAGTGCACTCCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30773
Summary {0: 1, 1: 4, 2: 62, 3: 1855, 4: 28851}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029677177_1029677180 4 Left 1029677177 7:102078122-102078144 CCAACCTGGAGTGCACTGGTACC 0: 1
1: 4
2: 62
3: 1855
4: 28851
Right 1029677180 7:102078149-102078171 TAGCTCATTTAACCGCCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029677177 Original CRISPR GGTACCAGTGCACTCCAGGT TGG (reversed) Intronic
Too many off-targets to display for this crispr