ID: 1029679189

View in Genome Browser
Species Human (GRCh38)
Location 7:102096261-102096283
Sequence AGTCAGGGGTTAGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029679189_1029679194 4 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84
1029679189_1029679199 24 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679199 7:102096308-102096330 AGGAGGATCGTAATGGAAAGTGG No data
1029679189_1029679198 17 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679189_1029679195 7 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029679189 Original CRISPR AGTCAGGGGTTAGCGGCCGC AGG (reversed) Intronic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
902375859 1:16029688-16029710 GGGCAGAGGTTAGAGGCCGCTGG - Intronic
915292558 1:154896463-154896485 AGGCAGGGGTGACCGGCCCCAGG + Intergenic
920642828 1:207770548-207770570 TGTCAGGGGTTAGGGGCTGGGGG - Intronic
1063117546 10:3082523-3082545 AGGCAGGGGTGAGCGAGCGCCGG - Intronic
1065342530 10:24721752-24721774 AGTTGGGGGTTACCGGCCACGGG - Intronic
1067069074 10:43119450-43119472 AGCCAGGGGTGGGAGGCCGCAGG - Intronic
1070054576 10:72923086-72923108 AGTCAGGGGTTAGAGACCAGTGG - Intronic
1072809224 10:98446552-98446574 AGTCAGCAGTTCGCCGCCGCGGG + Intronic
1077333105 11:1991992-1992014 AGGCAGGGATTAGGGGCAGCTGG - Intergenic
1202816087 11_KI270721v1_random:47170-47192 AGGCAGGGATTAGGGGCAGCTGG - Intergenic
1097248425 12:57619471-57619493 ACTCAGGGCTTAGCGGGCGGAGG + Intergenic
1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1122888100 14:104719485-104719507 AGTGAGGGGGCAGCGGCTGCTGG - Exonic
1126134335 15:45376533-45376555 AGTCAGAGGGTAGCAGCAGCAGG + Intronic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1130013593 15:80170970-80170992 AGATAGGGGTTAGAGGCCGTGGG + Intronic
1130224437 15:82046370-82046392 AGAGAGGCGTTAGCGGCGGCGGG - Intergenic
1132606948 16:797534-797556 AGTGAGGGGTGAGGGGCAGCTGG + Intronic
1136220167 16:28823413-28823435 AGGCAGGGGGAGGCGGCCGCTGG - Exonic
1136226786 16:28865225-28865247 AGTCTGGGGCCAGAGGCCGCAGG - Intronic
1141319749 16:82996295-82996317 AGTCATGGGGTAGAGGCCACTGG - Intronic
1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG + Intergenic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1154488416 18:14898277-14898299 AGTCAGGGGATGGCAGCCGGGGG + Intergenic
1158579667 18:58671049-58671071 AGTCAGGGGAGAGCGCTCGCCGG + Intergenic
1162303404 19:9857066-9857088 AGTGAGGGGTTAGAGGCCAAGGG + Intronic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
1171882730 20:30630584-30630606 GTTCAGGGGTCAGCGCCCGCTGG - Intergenic
1173915480 20:46705177-46705199 AGTCAGGAGTTAGAGGCTGAAGG + Intergenic
1175999144 20:62824367-62824389 ACGCAGGGGTCAGCGCCCGCGGG - Intronic
1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG + Intronic
1185300438 22:50077203-50077225 GGTGAGGGGTTGGCGGCCGCTGG - Intronic
949480974 3:4493540-4493562 GGAGAGGGGTTAGCAGCCGCTGG - Exonic
952251791 3:31663149-31663171 AGTCAGGGGTTACCAGCACCTGG + Intronic
957038888 3:75320938-75320960 AGACAGGAGTTAGAGGCCACAGG - Intergenic
961087046 3:124077101-124077123 AGACAGGAGTTAGAGGCCACAGG - Intergenic
976161118 4:82200807-82200829 ACTGAGGGGTGAGCGGCGGCGGG + Intergenic
995321270 5:110837006-110837028 AGCCAAGGGTTAGTGGACGCTGG + Intergenic
996242978 5:121225685-121225707 TGTCAGGGGTTAGGGGCCAAGGG + Intergenic
1019120785 6:169801977-169801999 AGGCAGGGGGTCGCAGCCGCAGG - Intergenic
1019983999 7:4641990-4642012 GGTCAGAGGTCAGCGGGCGCGGG + Intergenic
1024548878 7:50543953-50543975 CGGCAGGGATCAGCGGCCGCAGG + Exonic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1041254979 8:55972184-55972206 AGTCACGGGTCAGCAGCAGCCGG + Intronic
1043171081 8:76967480-76967502 AGTCAGAGATTAGAGGCAGCTGG - Intergenic
1044824917 8:96186588-96186610 AGTCAAGGGTTGGCAGCTGCCGG + Intergenic
1056617430 9:88180504-88180526 AGCCAGGGGTTCGGGGCAGCAGG - Intergenic
1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG + Intergenic
1062049316 9:134438881-134438903 TTTCAGGGGTTGGCGGCCGGGGG - Intronic
1062177919 9:135174598-135174620 AGTCAGGGGCCAGCGGCAGAGGG - Intergenic