ID: 1029679194

View in Genome Browser
Species Human (GRCh38)
Location 7:102096288-102096310
Sequence TGAACACCCTTCATTAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029679189_1029679194 4 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84
1029679188_1029679194 12 Left 1029679188 7:102096253-102096275 CCTTGGGACCTGCGGCCGCTAAC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84
1029679191_1029679194 -10 Left 1029679191 7:102096275-102096297 CCCCTGACTCTTCTGAACACCCT 0: 1
1: 0
2: 4
3: 27
4: 242
Right 1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84
1029679187_1029679194 16 Left 1029679187 7:102096249-102096271 CCAGCCTTGGGACCTGCGGCCGC 0: 1
1: 1
2: 2
3: 12
4: 133
Right 1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84
1029679190_1029679194 -3 Left 1029679190 7:102096268-102096290 CCGCTAACCCCTGACTCTTCTGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029679194 Original CRISPR TGAACACCCTTCATTAGTGA AGG Intronic
908030076 1:59989775-59989797 TGATCACCCAGTATTAGTGATGG + Intronic
909858959 1:80579218-80579240 GCAGCACCCTTGATTAGTGATGG - Intergenic
912629201 1:111232221-111232243 TGAACACCCTTCAATATGAATGG + Intronic
915267573 1:154729943-154729965 TGTAGACCCTTCATCAGTTATGG - Intronic
921182955 1:212645861-212645883 AGAAAAGCCTTCCTTAGTGATGG + Intergenic
1065148197 10:22794345-22794367 TGACCACCCTCCATTCATGATGG - Intergenic
1069577164 10:69538981-69539003 TCAACAGCCTTCAATATTGAAGG + Intergenic
1074565235 10:114571652-114571674 TTACCTCCATTCATTAGTGAAGG + Intronic
1075602254 10:123778382-123778404 TGAACACTCTTCAGGATTGATGG + Intronic
1076543857 10:131230970-131230992 TGAGCACCCTTCATTGTTTAGGG + Intronic
1097724173 12:63055678-63055700 TGAACACCCTGCAATAGTTGTGG + Intergenic
1105766342 13:23563494-23563516 TGCACACCCTGCATCAGTGATGG - Intergenic
1107321699 13:39195756-39195778 TAAAAAGCCTTAATTAGTGATGG - Intergenic
1111476599 13:88757658-88757680 GGAACATCCTTCCTAAGTGATGG + Intergenic
1113986689 13:114322432-114322454 TGAACACCTTCCCTTATTGACGG - Intronic
1114287898 14:21262600-21262622 TGCACACCCTTCCTGGGTGATGG - Intronic
1115058758 14:29165396-29165418 ACAACTCCCTTCATTAGTAAAGG + Intergenic
1122545246 14:102518104-102518126 TGCCCACCCTTCAAAAGTGATGG + Intergenic
1127411909 15:58717472-58717494 TGAAGACCTTGCATTAGAGAAGG + Intronic
1130207135 15:81887621-81887643 TTACCATCCTACATTAGTGAGGG - Intergenic
1131246936 15:90802533-90802555 TGAATAGGCTTCATTAGTGAGGG + Intronic
1132410531 15:101574968-101574990 TTAACATCCTGCATTAATGAAGG + Intergenic
1133107585 16:3523041-3523063 TGGAAACCCTTAATTAGAGAAGG - Intronic
1138819293 16:60239293-60239315 TCAAGAGCCTTGATTAGTGAAGG + Intergenic
1144168513 17:12635643-12635665 AGGACATCCTTCATAAGTGATGG - Intergenic
1148187025 17:45651550-45651572 TGACCAACCTGCTTTAGTGAAGG + Intergenic
1148873871 17:50675268-50675290 TGAACCCCTTTCATTAGAGTGGG + Intronic
1150158011 17:62870316-62870338 TGGACACCATACATAAGTGATGG - Intergenic
1153089986 18:1332049-1332071 TGAAAAACCTTCATTCCTGAAGG - Intergenic
1164620497 19:29693077-29693099 TGAGCACTCTTCCTGAGTGATGG + Intergenic
1164919082 19:32075201-32075223 GGAACACCTTTCAGTTGTGAAGG - Intergenic
1202634577 1_KI270706v1_random:33472-33494 AAAACACCCTTCAAAAGTGAAGG - Intergenic
1202651301 1_KI270707v1_random:6570-6592 AAAACACCCTTCAAAAGTGAAGG + Intergenic
939541483 2:143499453-143499475 TGAACAGACTTCAGTAGTGTGGG + Intronic
940768239 2:157813005-157813027 TGTATAGACTTCATTAGTGAAGG - Intronic
940816702 2:158305131-158305153 TGAACACCCATCACTGCTGAAGG + Intronic
941115398 2:161466441-161466463 AAAACACCCTTCAGGAGTGAAGG - Intronic
941772508 2:169360702-169360724 TGAACACCCTTTCTCAGTGTTGG - Intronic
942284270 2:174398161-174398183 TGAACATCCTTAATTAGATATGG + Intronic
948849924 2:240700954-240700976 TGCACATCCTTCAGTAGTTACGG - Intergenic
1168802467 20:652387-652409 TTAACACCCTTCCTCAGTGGTGG + Intronic
1173589728 20:44215242-44215264 TGGATTCCCTTCCTTAGTGAAGG - Intergenic
1176600836 21:8793066-8793088 AAAACACCCTTCAAAAGTGAAGG - Intergenic
1176627171 21:9101858-9101880 AAAACACCCTTCAAAAGTGAAGG + Intergenic
1178199746 21:30390367-30390389 TGAACTCCCTTTATTCCTGAAGG - Intronic
1179402244 21:41095061-41095083 TGAACACCCTGAATAGGTGAGGG + Intergenic
1180366130 22:11939757-11939779 AAAACACCCTTCAAAAGTGAAGG + Intergenic
1180417519 22:12781470-12781492 AAAACACCCTTCAAAAGTGAAGG + Intergenic
1181411476 22:22724333-22724355 TGAACATCACTAATTAGTGAGGG + Intergenic
949831287 3:8217358-8217380 TGCACACCCCACATTAGTCAAGG + Intergenic
955860278 3:63322139-63322161 TGCACACCCTCCATCAGTGTTGG - Intronic
958135253 3:89480494-89480516 TCAACTCCCTCCTTTAGTGAAGG + Exonic
959948708 3:112153926-112153948 TGAACATCCTTCTTTCATGAGGG + Intronic
962300931 3:134242449-134242471 TAAACAGCATTCATTTGTGAAGG - Intronic
963721983 3:148872025-148872047 TACACACCCTTCATTAGACAGGG + Intronic
966416654 3:179696172-179696194 TGAACACATCCCATTAGTGAAGG + Intronic
977507468 4:97920630-97920652 TCTACACCCTTCATTTTTGAAGG - Intronic
983297597 4:165885685-165885707 TGAACAACCTTCAATTCTGATGG - Intronic
983654559 4:170069604-170069626 TGAACACCCTTCAGTGCTGCTGG - Intronic
986908355 5:12522384-12522406 TTAACATCCTGTATTAGTGAAGG - Intergenic
987665573 5:20934615-20934637 TGACCACGCTTAATTAGTTATGG + Intergenic
988289813 5:29270650-29270672 TGGACATCCATCATTACTGAGGG + Intergenic
988757122 5:34267554-34267576 TGACCACGCTTAATTAGTTATGG - Intergenic
993456045 5:88128523-88128545 TAAACAGGCTACATTAGTGAAGG + Intergenic
993667314 5:90715948-90715970 AGAACACTCTTGATTTGTGAAGG + Intronic
996285988 5:121793070-121793092 TGCACACCATTCCTTAGTGAGGG - Intergenic
997212993 5:132088454-132088476 TGAACACCCTTCAGGAGTCAAGG - Intergenic
997306668 5:132842140-132842162 TTAATAACCTTTATTAGTGATGG + Intergenic
1001200340 5:169710291-169710313 TGATCACCCTTCCTTGGTGCAGG + Intronic
1006656705 6:35600902-35600924 TGATAACCCATCATTAGTGAGGG + Intronic
1010775544 6:79880691-79880713 TGAATACCCTTCATGCATGAGGG + Intergenic
1012405457 6:98891836-98891858 AGGACACCATTCATTAGAGATGG - Intronic
1014469129 6:121793464-121793486 TCAACACCCTTAGCTAGTGAAGG - Intergenic
1015041467 6:128725591-128725613 TGTACACTTTTCATCAGTGAAGG + Intergenic
1016912786 6:149215461-149215483 AGTACACCCTTCTTTAGTAATGG - Intergenic
1020782122 7:12530613-12530635 TGGACCCCCTTCATGAGTGAGGG - Intergenic
1029679194 7:102096288-102096310 TGAACACCCTTCATTAGTGAAGG + Intronic
1032450921 7:132030170-132030192 TGCACACCCTTCAATAGTCCAGG - Intergenic
1035589966 8:805187-805209 TGAAAACCCTTCATTATTCTGGG - Intergenic
1040006375 8:42624625-42624647 TGAACAACCTTCATTTATGTGGG + Intergenic
1042863204 8:73334137-73334159 TGAACACCCCTCAGTGCTGAGGG + Intergenic
1043590940 8:81833267-81833289 TAAAGACCATTCATTAGTTAGGG + Intronic
1045340013 8:101245292-101245314 TGGACACTCTTCAGTAGTAATGG - Intergenic
1048449923 8:134524183-134524205 TGAACACACTTATTTGGTGAGGG - Intronic
1049990960 9:990893-990915 TGGACACCCATCATCAGGGATGG - Exonic
1057266392 9:93620580-93620602 TGCCCACTCTGCATTAGTGAGGG + Intronic
1060808634 9:126595757-126595779 TGAACATCTTTCATTAATGGAGG + Intergenic
1187000512 X:15171936-15171958 TGAATAGCCTTCATTTGTGGAGG - Intergenic
1189521290 X:41771271-41771293 TGAATATCCTTCATGACTGAAGG + Intronic
1189699806 X:43706823-43706845 ATAAAACCCTTCATTATTGATGG + Intronic
1193373230 X:80724430-80724452 AGAACACCCTTCTATGGTGATGG - Intronic