ID: 1029679195

View in Genome Browser
Species Human (GRCh38)
Location 7:102096291-102096313
Sequence ACACCCTTCATTAGTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029679192_1029679195 -8 Left 1029679192 7:102096276-102096298 CCCTGACTCTTCTGAACACCCTT 0: 1
1: 0
2: 4
3: 24
4: 253
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1029679189_1029679195 7 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1029679191_1029679195 -7 Left 1029679191 7:102096275-102096297 CCCCTGACTCTTCTGAACACCCT 0: 1
1: 0
2: 4
3: 27
4: 242
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1029679190_1029679195 0 Left 1029679190 7:102096268-102096290 CCGCTAACCCCTGACTCTTCTGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1029679187_1029679195 19 Left 1029679187 7:102096249-102096271 CCAGCCTTGGGACCTGCGGCCGC 0: 1
1: 1
2: 2
3: 12
4: 133
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1029679188_1029679195 15 Left 1029679188 7:102096253-102096275 CCTTGGGACCTGCGGCCGCTAAC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1029679193_1029679195 -9 Left 1029679193 7:102096277-102096299 CCTGACTCTTCTGAACACCCTTC 0: 1
1: 0
2: 3
3: 24
4: 255
Right 1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029679195 Original CRISPR ACACCCTTCATTAGTGAAGG AGG Intronic
913246974 1:116878787-116878809 ACAACGTTCATTAGTAAAGGGGG - Intergenic
913645421 1:120849967-120849989 ACACCCTTGCTTTGTGTAGGGGG - Intergenic
914081309 1:144413571-144413593 ACACCCTTGCTTTGTGTAGGGGG + Intergenic
914176217 1:145282110-145282132 ACACCCTTGCTTTGTGTAGGGGG + Intergenic
914530943 1:148523596-148523618 ACACCCTTGCTTTGTGTAGGGGG + Intergenic
915453762 1:156025264-156025286 ACATCCTTCATGTGTGTAGGAGG - Intergenic
916972215 1:170034146-170034168 ACAACCTTTATTAGTTAATGAGG - Intronic
920640766 1:207750039-207750061 CCAGCCTTCATTTGTGAAAGTGG - Intergenic
921182956 1:212645864-212645886 AAAGCCTTCCTTAGTGATGGTGG + Intergenic
1069350956 10:67526809-67526831 ACACCTTTCAGTAGTGAATAAGG + Intronic
1070352628 10:75608158-75608180 ACACCCTTCTTTTTTTAAGGTGG - Intronic
1070363099 10:75709889-75709911 GCAGCCTTCATTAGAGAAGTAGG + Intronic
1070524853 10:77287025-77287047 ACACCCTTCCTAAGTGAATGTGG - Intronic
1071669023 10:87589723-87589745 AAATCCTTCATTCCTGAAGGGGG + Intergenic
1073448519 10:103595434-103595456 TGTCCCTTCATTAGGGAAGGAGG - Exonic
1073655885 10:105416101-105416123 ACACCCTGCAGTAGTGGTGGGGG - Intergenic
1075531925 10:123236951-123236973 ACACTCTTCCTGAGAGAAGGAGG - Intergenic
1079248250 11:18769078-18769100 ACATCCTCCATCAGTGAAGTGGG - Intronic
1087619059 11:100521576-100521598 AATTCCTTCATTAGAGAAGGTGG - Intergenic
1089191470 11:116656434-116656456 GCTCCCATCATTGGTGAAGGAGG - Intergenic
1090252040 11:125258352-125258374 AAACACGTCATTAGTGAAGCTGG + Intronic
1090469108 11:126963706-126963728 ACACATTTCATAAGTGTAGGAGG - Intronic
1092183591 12:6462740-6462762 ACCCCCTGCATTAGGCAAGGAGG + Intronic
1092606631 12:10127577-10127599 ACACCCTTTATAAGTGAAATGGG + Intronic
1092897782 12:13030031-13030053 ACAACCTCTATTAGTGAAGGAGG + Intergenic
1097153626 12:56996955-56996977 ACAGCCATGATAAGTGAAGGCGG + Intergenic
1100701050 12:97149051-97149073 ACACAATTCATTAGGGCAGGTGG - Intergenic
1100752197 12:97710634-97710656 ACACCCTTCAAAAGTGCTGGAGG - Intergenic
1105341815 13:19533677-19533699 ATACCCATCATTTATGAAGGAGG + Intronic
1106634300 13:31510640-31510662 ACAGCTTTCATTTGTGAAGATGG - Intergenic
1113594716 13:111522818-111522840 ACATCTCTCATTAGAGAAGGCGG + Intergenic
1114578298 14:23733189-23733211 AGATCCTTCCTTATTGAAGGAGG - Intergenic
1116911029 14:50464616-50464638 CCCCACTTCATCAGTGAAGGTGG - Intronic
1118841202 14:69513828-69513850 TCATCCTTCAAAAGTGAAGGAGG - Intronic
1119671489 14:76522789-76522811 AAACCCTTCAGGAATGAAGGGGG - Intergenic
1120318338 14:82926318-82926340 TAACCCTTCCTTAGTGAAAGTGG - Intergenic
1127422245 15:58817906-58817928 ACACTCTTGATGAGTGAAAGAGG + Intronic
1130207133 15:81887618-81887640 CCATCCTACATTAGTGAGGGAGG - Intergenic
1130380661 15:83369438-83369460 ACACTCTTCATCTGTAAAGGAGG + Intergenic
1132018232 15:98337927-98337949 CCAGCCTTCATAAGTGAAGGAGG + Intergenic
1138092165 16:54183918-54183940 ACACTCATAATTAGTGAAGGAGG + Intergenic
1139200449 16:64971006-64971028 TCCCCTTTCATTAGTTAAGGAGG - Intronic
1139924283 16:70477525-70477547 ATACCTTTCATTACTGAAGATGG + Intronic
1142993286 17:3746171-3746193 TCAGCCTTCTTTAGGGAAGGAGG + Intronic
1145924234 17:28633804-28633826 AGACCCTTCTGGAGTGAAGGAGG - Intronic
1146913564 17:36663812-36663834 AAACCCCACATTTGTGAAGGTGG - Intergenic
1148161846 17:45454602-45454624 AAACCCTCCATTTGTGCAGGAGG + Intronic
1150393078 17:64801247-64801269 AAACCCTCCATTTGTGCAGGAGG + Intergenic
1153772953 18:8429828-8429850 ACACGCTTCATTAATGATGATGG - Intergenic
1155089763 18:22495109-22495131 ACACTTTTTATTAGTCAAGGAGG + Intergenic
1156575670 18:38312359-38312381 ACACCCTGAATTTCTGAAGGTGG + Intergenic
1158080428 18:53583593-53583615 ACACACTTTATTGGGGAAGGAGG - Intergenic
1158682656 18:59582578-59582600 ACACCCTGGAGTAGTGATGGGGG + Intronic
1159023511 18:63162469-63162491 ACACCATTCTTTGGTGATGGTGG - Intronic
1167570858 19:50288171-50288193 CCTCCCATCATTAGTGAGGGTGG - Intronic
926344043 2:11929475-11929497 CCACCCCTCATTAGAGAATGGGG - Intergenic
926682577 2:15675229-15675251 ACACCCATCCTCACTGAAGGGGG - Intergenic
928445670 2:31331651-31331673 ACACCTTTCAGTAGGGAAGAAGG - Intergenic
928811088 2:35227291-35227313 ACTCCATTCATTAGTAAATGTGG - Intergenic
930018126 2:46984743-46984765 ACCCCATTCACTAGTGAGGGAGG + Intronic
931144834 2:59506207-59506229 TCACCCTTTATAAGGGAAGGTGG + Intergenic
938226402 2:129620104-129620126 CCACCCTACAGCAGTGAAGGAGG - Intergenic
939380943 2:141435585-141435607 ACACCCTGCACTGGTGCAGGAGG + Intronic
941996651 2:171607506-171607528 ACTCCCTTCTTTAGGGAGGGAGG + Intergenic
943831268 2:192465451-192465473 TCATCCTTCAAGAGTGAAGGAGG - Intergenic
948008380 2:234630303-234630325 TCAACCTTCATTATTAAAGGAGG + Intergenic
1173589725 20:44215239-44215261 ATTCCCTTCCTTAGTGAAGGGGG - Intergenic
1177943196 21:27436211-27436233 ATAAGCTTCATAAGTGAAGGAGG - Intergenic
949851073 3:8421057-8421079 ATACCCCTCATAAGTGCAGGTGG - Intergenic
951087585 3:18531800-18531822 ACACCCTTGATGAGTCAATGTGG - Intergenic
952382175 3:32814076-32814098 ACACCCTTTGTTAGCAAAGGAGG - Intergenic
953282418 3:41572133-41572155 AAACTCTTCATTGGTGAAGCTGG + Intronic
957033447 3:75270091-75270113 AAACTGTTCATTGGTGAAGGTGG - Intergenic
960050157 3:113231983-113232005 ACATCCATCATTAGTCATGGTGG + Intronic
960308107 3:116087380-116087402 AGAACATGCATTAGTGAAGGAGG + Intronic
963634822 3:147781261-147781283 ACACACTTCATTATAGAAGTAGG + Intergenic
965658942 3:171020422-171020444 ACCCCCTATATTAGTGAAAGGGG - Intronic
967296907 3:187974204-187974226 GCTGCATTCATTAGTGAAGGGGG - Intergenic
967816638 3:193804696-193804718 ACAGCCATCATTGGTGCAGGTGG - Intergenic
969200823 4:5604106-5604128 ACACCCCTCTGTAGTGAAGCAGG - Intronic
969866098 4:10077975-10077997 ACACCCATCCTTTGTGAAGGGGG + Intronic
971233599 4:24820710-24820732 ACATCCTTCATCACTGCAGGAGG + Intronic
973673433 4:53240035-53240057 GCACCTTTCATAAGTTAAGGAGG - Intronic
974880798 4:67754616-67754638 ACACTCTTCCTAAGTGAAGAAGG + Intergenic
976498584 4:85759442-85759464 ACCACCTTGATTAGAGAAGGAGG + Intronic
983560356 4:169095239-169095261 ACACAAGTCATTAGTGAAAGTGG - Exonic
984051729 4:174872837-174872859 TCACCCTTCACCAGTGCAGGTGG + Intronic
986856727 5:11877684-11877706 ACAACTATCATTATTGAAGGTGG - Intronic
988289814 5:29270653-29270675 ACATCCATCATTACTGAGGGAGG + Intergenic
994034519 5:95183737-95183759 ATTTCCTTCATTAATGAAGGTGG - Intronic
997306669 5:132842143-132842165 ATAACCTTTATTAGTGATGGTGG + Intergenic
1011148280 6:84242712-84242734 CCACTCTCCATGAGTGAAGGTGG - Intergenic
1012523486 6:100148902-100148924 AATCCCTTCATTAGTCAAGGAGG - Intergenic
1013739846 6:113269561-113269583 ACCACCTTCATTAGTGATGTTGG - Intergenic
1020961240 7:14805310-14805332 ACACCATTCAATAGTGAAAGTGG + Intronic
1021605501 7:22405529-22405551 ACCCCAGTTATTAGTGAAGGTGG - Intergenic
1022558681 7:31326611-31326633 TCACTCCTCATTTGTGAAGGAGG - Intergenic
1027593376 7:80141593-80141615 ACACCCTTCATTAGAAAAGAAGG - Intronic
1029679195 7:102096291-102096313 ACACCCTTCATTAGTGAAGGAGG + Intronic
1033544284 7:142385991-142386013 ACAGCCTTCATGAGAGGAGGTGG + Intergenic
1033723551 7:144087101-144087123 ACCTCCTTCATTTGTAAAGGAGG - Intergenic
1034526504 7:151666931-151666953 ATACCCTTCATTTCTGAAAGGGG - Intronic
1034878324 7:154744543-154744565 ACAGCTCTGATTAGTGAAGGAGG + Intronic
1040538443 8:48329949-48329971 AAACTCATCATTAGTGAAAGTGG - Intergenic
1043252729 8:78096025-78096047 AGATCCTTCATTAGTGAAGCTGG - Intergenic
1044729841 8:95220885-95220907 CCACCCTTCCTCAGAGAAGGGGG - Intergenic
1046859302 8:119072083-119072105 AAAGGCTTCCTTAGTGAAGGAGG - Intronic
1051242488 9:15074612-15074634 ATACCCTTCAAAAGTGAAAGTGG - Intergenic
1052702689 9:31957735-31957757 ACACACTTCATTACCCAAGGAGG + Intergenic
1061475572 9:130863632-130863654 ACACTATTCATTAGTGGAGAGGG - Intronic
1190292131 X:49000062-49000084 CCTCCCTTAATTATTGAAGGGGG - Intronic
1193431356 X:81410299-81410321 ACTCTGTTCATTTGTGAAGGAGG - Intergenic
1195817635 X:108905536-108905558 ATAAACTTCATAAGTGAAGGAGG + Intergenic
1197359400 X:125480771-125480793 ACATCCTTCATTATTGATAGGGG + Intergenic