ID: 1029679198

View in Genome Browser
Species Human (GRCh38)
Location 7:102096301-102096323
Sequence TTAGTGAAGGAGGATCGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029679191_1029679198 3 Left 1029679191 7:102096275-102096297 CCCCTGACTCTTCTGAACACCCT 0: 1
1: 0
2: 4
3: 27
4: 242
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679188_1029679198 25 Left 1029679188 7:102096253-102096275 CCTTGGGACCTGCGGCCGCTAAC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679192_1029679198 2 Left 1029679192 7:102096276-102096298 CCCTGACTCTTCTGAACACCCTT 0: 1
1: 0
2: 4
3: 24
4: 253
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679187_1029679198 29 Left 1029679187 7:102096249-102096271 CCAGCCTTGGGACCTGCGGCCGC 0: 1
1: 1
2: 2
3: 12
4: 133
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679193_1029679198 1 Left 1029679193 7:102096277-102096299 CCTGACTCTTCTGAACACCCTTC 0: 1
1: 0
2: 3
3: 24
4: 255
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679189_1029679198 17 Left 1029679189 7:102096261-102096283 CCTGCGGCCGCTAACCCCTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data
1029679190_1029679198 10 Left 1029679190 7:102096268-102096290 CCGCTAACCCCTGACTCTTCTGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1029679198 7:102096301-102096323 TTAGTGAAGGAGGATCGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029679198 Original CRISPR TTAGTGAAGGAGGATCGTAA TGG Intronic
No off target data available for this crispr