ID: 1029680452

View in Genome Browser
Species Human (GRCh38)
Location 7:102105096-102105118
Sequence TGTCCCCAGAGGACACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029680452 Original CRISPR TGTCCCCAGAGGACACACAC TGG (reversed) Intronic
900107876 1:993105-993127 CCTCCCCAGATGACAGACACGGG - Intergenic
900197018 1:1381581-1381603 ACGCCCCAGAGGACACAGACAGG - Intergenic
900584451 1:3425772-3425794 AGCCCCCAGAGCACCCACACGGG + Intronic
900798284 1:4722750-4722772 TGTCCTTAGAAGACAGACACAGG - Intronic
901333634 1:8429868-8429890 GCTCCCCCGAGGAGACACACAGG + Intronic
902821690 1:18947329-18947351 TGTGCCCTGAGGACACTCAGGGG + Intronic
903579414 1:24359604-24359626 TGCCCCCAGAGGCCACAGTCAGG - Intronic
903685825 1:25131163-25131185 TGTCCCCAGAGATCTCAGACAGG - Intergenic
904584266 1:31570823-31570845 AGACCCCAGAGGGCACAGACAGG - Intergenic
905121328 1:35684306-35684328 TGTCCTCTGAGGTCACACCCAGG + Intergenic
906633935 1:47395708-47395730 TGTCCCCAGAAGACATGCTCTGG - Intergenic
908231214 1:62106905-62106927 TGCCCCCAGTGCACACACACAGG - Intronic
910902358 1:92134793-92134815 TGTCCCCTTAGCCCACACACAGG + Intronic
911043646 1:93611019-93611041 TTTCCGCAGAGGACACACCAAGG - Intronic
913971574 1:143421516-143421538 TGTTCCCAGAGTACACACCTGGG - Intergenic
914065951 1:144247129-144247151 TGTTCCCAGAGTACACACCTGGG - Intergenic
914113200 1:144719225-144719247 TGTTCCCAGAGTACACACCTGGG + Intergenic
914239866 1:145846192-145846214 TGTCCCCAGAATACTCACCCGGG - Exonic
917233467 1:172864020-172864042 TGTCCCCAAAGGCCACACCTTGG + Intergenic
917797103 1:178540490-178540512 GGTCCCCAGAGGACATGCATGGG - Intronic
918608361 1:186457358-186457380 TGTCTCCACAAGAGACACACAGG + Intronic
918947657 1:191090340-191090362 TGTGACCAGAGCACACACAGTGG - Intergenic
920969657 1:210732228-210732250 TACCCCCAGAGGAGCCACACTGG - Intronic
921841984 1:219838491-219838513 GGTCACCAGAGCACACACTCTGG - Intronic
922739085 1:228005743-228005765 TATCCCCAGAGAACACACCACGG + Intergenic
924197244 1:241621039-241621061 TTTCCCCAGAGGTCACCAACAGG - Intronic
924321871 1:242858884-242858906 TGTCCCCAGAGGAAACAGTCAGG + Intergenic
924392794 1:243581176-243581198 GGTCCCCTGATGACAGACACAGG - Intronic
924609330 1:245560840-245560862 TCTCTCCAGAGCACACACACGGG - Intronic
1064655217 10:17549710-17549732 TCACCCCAGAGAAGACACACAGG + Intergenic
1066480376 10:35789625-35789647 TGCCCCCAGAGGTAACCCACTGG - Intergenic
1066656727 10:37704135-37704157 TGGCCCCAGAGAAAAGACACAGG + Intergenic
1069511224 10:69043932-69043954 TGCCTCCAGAGGAGACACACAGG + Intergenic
1069538144 10:69270843-69270865 TGTCCCCAGAGCCTACATACTGG + Intronic
1069615873 10:69805919-69805941 TGTCCTCATGGGGCACACACAGG + Intronic
1072656322 10:97333067-97333089 AGTCTCCCGAGGACACAAACAGG - Exonic
1072707584 10:97692412-97692434 TGTTCCCAGTGGAGTCACACTGG + Intergenic
1074555913 10:114489815-114489837 TGTGCCGAGAGGGCACACAAAGG + Intronic
1075105384 10:119536806-119536828 AGGCCCCAGAGGACACACAGGGG - Intronic
1075467603 10:122663331-122663353 TATCCCATTAGGACACACACAGG - Intergenic
1075780776 10:125015891-125015913 TGTCCAGTGTGGACACACACGGG + Intronic
1076016351 10:127030408-127030430 TGTCCCCAGATGTGCCACACTGG + Intronic
1076250392 10:128979956-128979978 GGTGGCCAGAGGACACCCACAGG - Intergenic
1076385554 10:130052469-130052491 TGCCCCCAGATGACACAGCCAGG + Intergenic
1077061873 11:621079-621101 TGTCCCCACGGGGCACATACTGG - Exonic
1077308302 11:1877511-1877533 TGTTCCCAGAGTACACACCTGGG + Intronic
1079347691 11:19667441-19667463 TGCCCCCAAAGCACACCCACAGG - Intronic
1081589746 11:44413256-44413278 TGCCCCAAGAAGACATACACTGG - Intergenic
1084265734 11:68004228-68004250 ACACCCCAGAGGGCACACACAGG - Intronic
1085974114 11:81631295-81631317 TGTCCCCAGGGAACAGCCACAGG + Intergenic
1086368245 11:86130283-86130305 TCTCCCCAAAGGCCACACACGGG + Intergenic
1088346054 11:108826743-108826765 TGGACCCAGAGGACACAAAATGG - Intronic
1088898883 11:114099945-114099967 AGACGTCAGAGGACACACACTGG - Intronic
1089189727 11:116644992-116645014 TGTACCCTGAAGACACTCACGGG + Intergenic
1089376188 11:117996340-117996362 TGTAGCAAGAGGACACACCCTGG - Intronic
1090648639 11:128787241-128787263 TGGCACCAGAGGGCACAAACGGG - Intronic
1091015211 11:132044655-132044677 TGTCACTAGAGGACATGCACTGG - Intronic
1091025994 11:132141846-132141868 TGTCCACGGGGGCCACACACAGG + Intronic
1092623867 12:10304210-10304232 TTTCCCCTTAGGACACACTCTGG + Intergenic
1092791221 12:12072383-12072405 TGTTCCCAGAGGACACGCTGGGG + Intronic
1094491258 12:30962327-30962349 TGTCCCCAGATCCCACAGACTGG - Intronic
1096727443 12:53576077-53576099 AGACACCAGAGGACACACCCAGG + Intronic
1098991398 12:77067844-77067866 TGTCCTCATAGGAGACACACAGG - Intergenic
1101837286 12:108304346-108304368 TGAGCCCATAGGACACACACCGG - Intronic
1102416440 12:112766931-112766953 GGGCCCCAGAGCACACACAAAGG + Intronic
1103908280 12:124338604-124338626 TGTCACCAGAGGGCACTCAGGGG + Intronic
1104739875 12:131164617-131164639 TGTGCCCTGAGGCCCCACACTGG + Intergenic
1104958591 12:132477583-132477605 GATCCCAAGAGGACACACCCAGG - Intergenic
1104958599 12:132477616-132477638 GATCCCAAGAGGACACACCCAGG - Intergenic
1104961962 12:132492466-132492488 AGACCCCATAGGAGACACACAGG - Intronic
1105061553 12:133156342-133156364 AGACACCAGAGGACACATACTGG + Exonic
1105475944 13:20728290-20728312 GCTCCGCAGAGGTCACACACTGG - Intergenic
1105833985 13:24192666-24192688 TGGCCCCAGAGCACACAGATAGG + Intronic
1106133966 13:26960838-26960860 CTTCCCCAGAGGACAGACAGTGG - Intergenic
1107624254 13:42267052-42267074 TGTCCCTAGGAGACACACAGGGG + Intergenic
1108292273 13:48974009-48974031 TGTTCCCAGAGAACTCATACTGG + Intergenic
1108355293 13:49624544-49624566 GGCACGCAGAGGACACACACAGG - Intergenic
1109049570 13:57460955-57460977 TGGCCCCAGAGGTCACATATTGG + Intergenic
1110286090 13:73751920-73751942 TGTACCCTGAGGACACACACAGG + Intronic
1112953961 13:105036646-105036668 TGTCCTGGGAGCACACACACCGG + Intergenic
1113395056 13:109939941-109939963 TGACCACACAGGAAACACACAGG - Intergenic
1113823182 13:113230045-113230067 TGGCCACAGAGGACACACAGGGG - Intronic
1113893231 13:113747623-113747645 TGTGCCCAGAGGATTCGCACAGG - Intergenic
1114822034 14:26032253-26032275 TCTACCCAGAGGACACTCACTGG - Intergenic
1118259194 14:64232104-64232126 TGGCCCCAGAGCTGACACACTGG + Intronic
1118700519 14:68428279-68428301 TGTGGCTAGAGGACACACAAAGG - Intronic
1119377148 14:74204032-74204054 TCTACCCAGAGGACAGACATGGG + Intergenic
1119752378 14:77088834-77088856 TTTCCCCAGTGGCCATACACAGG + Intergenic
1119991320 14:79200863-79200885 TGTCCCCTGAGGATAAACAGAGG - Intronic
1121982485 14:98467088-98467110 TGTCTCCAGAAGACAGACATGGG + Intergenic
1122006266 14:98706320-98706342 TGTTCCCAGAGAATGCACACAGG + Intergenic
1122437843 14:101711711-101711733 AGTCCTCAGAGGAAACACAGAGG + Intergenic
1122774645 14:104111810-104111832 TGTCCCCAGCCCACACACACAGG - Intronic
1122908730 14:104815945-104815967 TGTCCGCAGAGTAGACAGACGGG + Intergenic
1122916762 14:104862985-104863007 TCTCCATAGAAGACACACACTGG - Intergenic
1123002892 14:105305806-105305828 TGCCCTCAGAGCACCCACACTGG + Exonic
1124594914 15:31084088-31084110 TGTCCCCAGAGGAGAGCCCCTGG - Intronic
1125456863 15:39868832-39868854 TATCTGCAGAGGACAGACACTGG - Intronic
1125500850 15:40239623-40239645 CACCTCCAGAGGACACACACAGG - Exonic
1125604393 15:40931803-40931825 GGTCCCCTGAGGAAACACAGTGG + Intronic
1125775214 15:42206727-42206749 TGTGCTCCTAGGACACACACTGG - Intronic
1127914458 15:63443874-63443896 TGGCCCAAGAGGACCCTCACAGG - Intergenic
1128326847 15:66729496-66729518 TGTCCCCAGGACACACAGACGGG + Intronic
1128989105 15:72243770-72243792 TCTCCCTGGTGGACACACACAGG - Intronic
1129389471 15:75213471-75213493 TGGCCCCAGAGGACTCAGAATGG + Intergenic
1130076946 15:80696995-80697017 AGTCCCCAGAGGAAGTACACCGG + Intronic
1131196641 15:90360669-90360691 ACTCACCAGAGGACCCACACAGG + Exonic
1132588296 16:715575-715597 TGTCCCCAGCGGCCTCACCCAGG + Exonic
1132642618 16:984692-984714 TGTCCCCAGGGCAGACCCACGGG + Exonic
1132645412 16:997230-997252 TCTCCCCACTGGACACACCCAGG + Intergenic
1132751197 16:1458505-1458527 TTTCGCCAGAGGGGACACACTGG + Intronic
1133068061 16:3224253-3224275 TCCCACCAGAGGACCCACACTGG - Exonic
1133308779 16:4829191-4829213 TCTCACCAGAGGCCTCACACTGG + Intronic
1134452025 16:14369476-14369498 TGTCTGCAGAGGACACAGGCAGG - Intergenic
1135410413 16:22230014-22230036 GGACCCCAGAGGAGACCCACGGG - Intronic
1135435770 16:22425711-22425733 TTTCCCCAGGGGACACTCATGGG - Intronic
1135794705 16:25430761-25430783 TGTCTTCAGAGAGCACACACTGG + Intergenic
1136571307 16:31098831-31098853 TAGCCTCAGAAGACACACACTGG + Intergenic
1138526474 16:57610668-57610690 TGACCCCAGAGGACAAACCTGGG + Intronic
1140975749 16:80058493-80058515 TGTCCCCAGCATACACCCACAGG + Intergenic
1142044975 16:87919515-87919537 TTTCCCCAGGGGACACTCACGGG - Intronic
1142224833 16:88872314-88872336 GGTGGCCAGAGGACACACAGAGG + Intergenic
1142436003 16:90057869-90057891 ATTCACCAGAGGACACACAGGGG - Exonic
1142436018 16:90057953-90057975 AGTCACCAGAGGACACACACAGG - Exonic
1146774981 17:35605967-35605989 TTTCCCTGGATGACACACACTGG - Intronic
1147459603 17:40559833-40559855 TGGCCCGAGAGGACACAGAAGGG + Intronic
1147561536 17:41512453-41512475 TGTCTCCTGAGAACGCACACAGG - Intergenic
1147610543 17:41799455-41799477 GGGCCCCAGAGGGCCCACACTGG + Intergenic
1149802006 17:59578218-59578240 TTTACCCAGAAGAAACACACAGG - Intronic
1149844484 17:59997267-59997289 TTTACCCAGAAGAAACACACAGG + Intergenic
1151207255 17:72516928-72516950 TCGCCCCACAGGACACACACAGG + Intergenic
1152563864 17:81091534-81091556 TGACCCCACAGGGCATACACTGG - Intronic
1152865854 17:82722519-82722541 GGGCACCAGAGGACACACACAGG - Intronic
1154235056 18:12597347-12597369 GGGCTCCAGAGCACACACACAGG + Intronic
1156368219 18:36448847-36448869 AGTCCCCAGAGGAGACACAGAGG - Intronic
1157284600 18:46369160-46369182 TGTCCACAGAGCATACACACAGG - Intronic
1157586958 18:48807135-48807157 TGTGTCAAGAGGAGACACACAGG + Intronic
1158283013 18:55848623-55848645 AGTGGCCAGAGGACACACAACGG - Intergenic
1158850793 18:61494237-61494259 TAAGCCCAGAGGACACACACAGG + Intronic
1160483916 18:79270823-79270845 TGTCCCCAGAGTTCAGGCACAGG + Intronic
1160604735 18:80041474-80041496 TGTGCCCAGTGGACACGCCCTGG - Intronic
1161174724 19:2834508-2834530 TTGCACAAGAGGACACACACCGG + Exonic
1161264749 19:3359108-3359130 TGTGCCCGGCGGACACCCACGGG + Intergenic
1161915367 19:7224389-7224411 TTTCCCCAGAGCACAAACAGAGG + Intronic
1162594539 19:11617389-11617411 AGTCACGAGAGGACTCACACCGG + Exonic
1163390252 19:17026531-17026553 TGTCGCCGGAGGATACTCACGGG + Exonic
1164739628 19:30566713-30566735 TGTCCGGAAAGGCCACACACAGG - Intronic
1165346470 19:35251612-35251634 GGTCCGCAGAGGACTCACAGAGG + Intronic
1165358142 19:35316679-35316701 TGTCCCCTGACGACAGACTCTGG + Intergenic
1166138147 19:40789995-40790017 TGTACCCACAAAACACACACAGG - Intronic
1166633546 19:44429327-44429349 AGTCATCAGAAGACACACACCGG - Exonic
1167813917 19:51861731-51861753 GGTCACCAGAGAACTCACACAGG - Intronic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
1168173614 19:54607600-54607622 TGTCCACAGAACACACACAAAGG - Intronic
1168427071 19:56247276-56247298 TGTCACAAGAGGAGCCACACGGG + Exonic
1168653314 19:58107937-58107959 TGGCACCAGAGGACTCATACTGG - Intronic
1168653382 19:58108604-58108626 AGTCACCAGAGGACTCATACTGG - Intronic
1168678278 19:58294880-58294902 CGGCACAAGAGGACACACACTGG + Exonic
1168722598 19:58562415-58562437 CGTCATCAGAGGACACACACCGG - Exonic
925101509 2:1250300-1250322 TGTTGCCAGAGGAAACATACAGG - Intronic
927929684 2:27036191-27036213 TGTTTCCAGAGCACACACACAGG - Intronic
930770784 2:55128510-55128532 TGTCCCCAGGGGACAGAATCTGG - Intergenic
933220958 2:79687498-79687520 ATTACCCAGAGGGCACACACTGG + Intronic
933991348 2:87636271-87636293 TTTCCCCATAGGAGCCACACCGG + Intergenic
934176270 2:89582449-89582471 TGTTCCCAGAGTACACACCTGGG - Intergenic
934286580 2:91656810-91656832 TGTTCCCAGAGTACACACCTGGG - Intergenic
934545852 2:95215334-95215356 CGTCATCAGAGAACACACACTGG + Exonic
936078706 2:109418043-109418065 GCTCACCTGAGGACACACACTGG + Intronic
936302494 2:111314551-111314573 TTTCCCCATAGGAGCCACACCGG - Intergenic
936977380 2:118233096-118233118 ATTCCCCAGAGGACTCCCACAGG - Intergenic
941920331 2:170844064-170844086 TGTTCCATGAGGACAAACACTGG - Exonic
945083443 2:206108721-206108743 CGGTCACAGAGGACACACACAGG + Intergenic
947530802 2:230907585-230907607 GGTCCCCAGGGCACACCCACAGG + Exonic
948112069 2:235464206-235464228 TGGCCCCAGAAGACACAGACAGG + Intergenic
948504426 2:238418357-238418379 TGTGCCCTGGAGACACACACAGG - Intergenic
948717649 2:239875579-239875601 TGTCCCCAGTGGGCACAGCCAGG + Intergenic
948786923 2:240357471-240357493 TGTCCCCAGATGCCACGCAGAGG - Intergenic
948954110 2:241273437-241273459 TGGGCTCAGAGGCCACACACCGG - Intronic
1169039828 20:2483831-2483853 AGACACCAGAGGACACACTCCGG - Exonic
1169041442 20:2498863-2498885 TGTCTCCAGAGCCCACACCCAGG + Intronic
1169722597 20:8695318-8695340 TGTGCCCCGTGGAGACACACAGG - Intronic
1171047851 20:21827659-21827681 TGTCCCCAGAGTAGAGACATGGG - Intergenic
1171169403 20:23001879-23001901 TATGCCCAGAGGCCACACTCTGG - Intergenic
1171336134 20:24387457-24387479 CGTGCCCAGAGGACACACTTTGG + Intergenic
1171372939 20:24673410-24673432 TATCCACAGAGGACAGAGACAGG + Intergenic
1171510238 20:25676509-25676531 AGACACCAGAGGACACACTCAGG - Exonic
1173229721 20:41184737-41184759 AATCCCCAGAGAACAGACACAGG + Exonic
1174046696 20:47738935-47738957 TGTCCACATAGGACACAAAGTGG + Intronic
1175612443 20:60363031-60363053 AGTGCCCAGAGGACACACGGAGG + Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175981846 20:62742675-62742697 TGTCCTCAGAGGAGACACCATGG - Intronic
1176051617 20:63122671-63122693 TGCCCCCTGAAAACACACACAGG - Intergenic
1176200826 20:63859549-63859571 TGCCCCAGGAGGAAACACACAGG - Intergenic
1176270346 20:64232994-64233016 TGTCACCATAGGACACAGACAGG - Intronic
1178106081 21:29320799-29320821 GGTCCCCAGAGGTCACACCTTGG - Intronic
1180145433 21:45916004-45916026 TGCCCCCAGAGCACTCACAGTGG - Intronic
1180174061 21:46078982-46079004 TGTCACCAGAGGAAACACTTGGG + Intergenic
1180387288 22:12189803-12189825 TGTCCCCAGTTGACACAGTCTGG - Intergenic
1181978725 22:26751362-26751384 TGACCCCAGATGACCCCCACAGG - Intergenic
1183522634 22:38304181-38304203 TGTCGCAACAGGACACAAACAGG + Intronic
1183696804 22:39428225-39428247 TGGTGCCACAGGACACACACGGG - Intronic
1184092324 22:42299227-42299249 TGAGCCCAGAGGACAATCACAGG + Intronic
1184945735 22:47802563-47802585 TGTCCCCAGATGACTAGCACAGG - Intergenic
949563030 3:5220428-5220450 GGTCCCCAGTGGCAACACACAGG - Intergenic
950129865 3:10534586-10534608 TGCCCTCACAGGCCACACACAGG - Intronic
950357079 3:12420656-12420678 TGTCCCTAGAGGACCCAAAGAGG + Intronic
950642950 3:14360205-14360227 TCTCCCCTGAGCACAGACACAGG + Intergenic
952970430 3:38647484-38647506 TGTCCCCAGAGCCCATTCACAGG - Intronic
954088795 3:48268484-48268506 ATACACCAGAGGACACACACAGG + Exonic
954088887 3:48269240-48269262 AGACACCAGAGGACACACACAGG + Exonic
954794813 3:53156087-53156109 TGTCCCTTGAGGACACAATCGGG - Intronic
955556487 3:60143245-60143267 TGGCCCCAGAGGCCATATACAGG - Intronic
955695791 3:61634750-61634772 TGTTCCCAGAGGATAAGCACAGG - Intronic
959973923 3:112437202-112437224 TGTCCCCCCAGGAAACACTCAGG + Intergenic
962087868 3:132210733-132210755 TGTCCCCAGCAGACACACCTAGG + Intronic
962250512 3:133833358-133833380 TGTCACCAGAGGACAAGCAGTGG - Intronic
963650625 3:147975368-147975390 TGTCCCCAGTGGAGAACCACTGG + Intergenic
963918570 3:150884017-150884039 TCCACCCAGAGCACACACACAGG - Intronic
964178608 3:153856556-153856578 TGTCCCCAAAGAGCATACACTGG + Intergenic
965350201 3:167602197-167602219 TGGCCCCAAAGGACACCCACTGG + Exonic
965906124 3:173708662-173708684 TGTCCCCTGAGGAGAAATACAGG + Intronic
966532235 3:180993836-180993858 TGTCCCCAGATTCCAAACACAGG - Intergenic
968617473 4:1584777-1584799 TGTCCCAAGAGGACAGGCAGAGG + Intergenic
969575435 4:8033684-8033706 TGTCCCCAGAGGGCAGAGAAGGG - Intronic
970932934 4:21534717-21534739 TCTTCCCAGAGCACACACCCTGG + Intronic
971149032 4:24011516-24011538 TCTCACCAGAGGTCACAGACTGG - Intergenic
972249191 4:37281251-37281273 TGTCACACGAGGACACCCACTGG - Intronic
977811200 4:101357837-101357859 AGTCTCCAGAGGACCCCCACAGG - Intergenic
978319635 4:107479309-107479331 TGTCCCAAGATGACGTACACTGG - Intergenic
980808021 4:137838203-137838225 TGTCCCCAGGTGATATACACTGG - Intergenic
984693081 4:182751233-182751255 TAACCCCATAGGACAGACACTGG + Intronic
987116876 5:14732714-14732736 TTTCCCCAGATGCCACACAGAGG - Intronic
987865006 5:23526793-23526815 ATTCACCAGAGGATACACACAGG + Exonic
987865023 5:23526877-23526899 ACTCACCAGAGGACACACACAGG + Exonic
987865041 5:23526961-23526983 ACTCACCAGAGGAGACACACAGG + Exonic
987865059 5:23527045-23527067 ACTCACCAGAGGAGACACACAGG + Exonic
987865076 5:23527129-23527151 ACTCACCAGAGGACACACACAGG + Exonic
987865093 5:23527213-23527235 ACTCACCAGAGGACACACACAGG + Exonic
987865109 5:23527297-23527319 AGACACCAGAGGACACACACAGG + Exonic
987865125 5:23527381-23527403 AGACACCAGAGGACACACACAGG + Exonic
987865141 5:23527465-23527487 AGTCACCAGAGGACACACACAGG + Exonic
987865157 5:23527549-23527571 AGACACCAGAGGACACACACAGG + Exonic
987865173 5:23527633-23527655 AGACACCAGAGGACACACACAGG + Exonic
987865189 5:23527717-23527739 TATCACCAGAGGACACACACAGG + Exonic
990974615 5:61548437-61548459 TTACCTCAGAGAACACACACTGG - Intergenic
990990570 5:61679359-61679381 TGTCCCTGCAGGACAGACACTGG - Intronic
997580524 5:135014005-135014027 TCTCACCACATGACACACACGGG - Intergenic
999946123 5:156597691-156597713 AGTCCCCAGAGGACACAGAGGGG - Intronic
1001037626 5:168309066-168309088 TGTCACCAGGGGCCACACAGTGG + Intronic
1002364791 5:178701459-178701481 GGTCCGCACAGGTCACACACTGG + Intergenic
1002477485 5:179476209-179476231 AGTCTCCAGAGGACGCAAACGGG + Intergenic
1002605241 5:180379214-180379236 TGTCCTTAGAGGAGACACAGAGG - Intergenic
1003095407 6:3139410-3139432 TGTCCCGAGATGACACACACCGG - Intronic
1004449687 6:15733780-15733802 TCTCCACAGAATACACACACGGG + Intergenic
1011324093 6:86129887-86129909 GGTCCCCAGACAACACACACAGG - Intergenic
1012287963 6:97416330-97416352 TTTCCCCAGAGAACATACACTGG - Intergenic
1014325361 6:119986627-119986649 AGACCCTAGTGGACACACACAGG + Intergenic
1016323864 6:142877771-142877793 TGTCCCCAAAAGAAATACACTGG + Intronic
1018553359 6:165024516-165024538 TGTCCCCACAGAACAGACCCTGG + Intergenic
1018920575 6:168169623-168169645 TGGGGACAGAGGACACACACTGG - Intergenic
1019893370 7:3964235-3964257 TTTCCCCACAGGACCCACAAAGG - Intronic
1019919069 7:4151269-4151291 TGGCCCCAGAGGACCCACCCTGG + Intronic
1022293811 7:29030444-29030466 GGGCCACAGAAGACACACACTGG + Intronic
1023664989 7:42513609-42513631 TGTCCCAAGAGTCCACACATAGG + Intergenic
1024053674 7:45646079-45646101 TGTCCCCAACGGTCAGACACAGG - Intronic
1024288224 7:47778904-47778926 TGTGCCCATAGAACAGACACTGG + Intronic
1024587507 7:50854552-50854574 TGGCCCAGGAGGACAGACACAGG + Intergenic
1025117527 7:56270994-56271016 TGTCCTCAGAGGACAGAGTCTGG - Intergenic
1026201414 7:68217897-68217919 TGTCCTCAGAGGACAGAGTCTGG - Intergenic
1026727290 7:72879637-72879659 AGGCCGCCGAGGACACACACGGG - Exonic
1027275261 7:76549613-76549635 AGGCCTCTGAGGACACACACGGG - Intergenic
1029289843 7:99493986-99494008 AAGCACCAGAGGACACACACAGG - Exonic
1029452405 7:100648538-100648560 TGTCCCCAGAGGCCCCACCTTGG + Exonic
1029680452 7:102105096-102105118 TGTCCCCAGAGGACACACACTGG - Intronic
1029720972 7:102364163-102364185 AGGCCGCCGAGGACACACACGGG - Exonic
1031154076 7:118088147-118088169 TGTCACCTGAGGAAACAAACAGG + Intergenic
1034256871 7:149729479-149729501 TTTCCCCAGAGGACAGAAGCTGG + Intronic
1034539751 7:151749664-151749686 TTTCCCCAAAGAAGACACACAGG + Intronic
1034866729 7:154648439-154648461 TGTCCCCAGCGCAGACACAGTGG - Intronic
1035362675 7:158323726-158323748 TGTCCCCAAAACACAAACACAGG + Intronic
1035694695 8:1586323-1586345 TGTTTCCAGAGGCCACCCACAGG + Intronic
1038943910 8:32336085-32336107 TGTCCAGAGAAGACACCCACAGG + Intronic
1039910922 8:41826297-41826319 TGTCCCCAGAGAAAACAGGCTGG + Intronic
1040776242 8:51046158-51046180 TGCCACCAGAGGACACATAAAGG + Intergenic
1040943491 8:52856592-52856614 TGTCCTCAGAAGACATACAACGG + Intergenic
1042130756 8:65585000-65585022 TGTCCCCAGCGTGTACACACAGG + Intergenic
1047452402 8:124977133-124977155 CGCCACCAGCGGACACACACAGG + Exonic
1049266426 8:141670296-141670318 TCTGCCCAGAGGACAGCCACAGG - Intergenic
1052003077 9:23311307-23311329 TGAACCCAGAGGGCACACGCGGG + Intergenic
1053194949 9:36110094-36110116 TGGCCCCTGAGGACAGACTCTGG - Intronic
1053632261 9:39956015-39956037 TGTCTTCAGAGGAAACATACTGG - Intergenic
1053773499 9:41507515-41507537 TGTCTTCAGAGGAAACATACTGG + Intergenic
1054211627 9:62294682-62294704 TGTCTTCAGAGGAAACATACTGG + Intergenic
1054313360 9:63554165-63554187 TGTCTTCAGAGGAAACATACTGG - Intergenic
1056101050 9:83301102-83301124 GGACCCCTGAGGACACACAGAGG + Intronic
1057041782 9:91853360-91853382 TGGCACCAGAGGACACAGCCTGG + Intronic
1057200392 9:93136782-93136804 TGTCCCCAGGAGAGACACAGAGG + Intergenic
1057351200 9:94300309-94300331 AAGCACCAGAGGACACACACCGG + Exonic
1057351284 9:94300813-94300835 AGGCACCAGAGGACACACACAGG + Exonic
1057351305 9:94300897-94300919 GGACACCAGAGGACACACACAGG + Exonic
1057351322 9:94300981-94301003 AGACACCAGAGGACACACACAGG + Exonic
1057514280 9:95708257-95708279 TCTCCCCAGAGCCCACTCACTGG - Intergenic
1060413514 9:123415275-123415297 TGTCACCAGAGGAAACACACAGG + Intronic
1060516283 9:124267764-124267786 TGGCCCCTGGGGAAACACACAGG + Intronic
1060551197 9:124486205-124486227 TGCCCCCAGAGGTCAGCCACAGG + Intronic
1061800581 9:133111599-133111621 TGTCCTCAGAGGACTCACAGTGG + Intronic
1062021796 9:134323080-134323102 TGTCCCCAAAGGAGCCACAACGG + Intronic
1062204019 9:135325824-135325846 TGACCCCAGAGGGCAAACCCAGG - Intergenic
1187363596 X:18649475-18649497 TGTCCCCAGAGGCTAAAAACAGG + Intronic
1189179756 X:38992504-38992526 TCTCCTCAGAGGACACCCCCCGG + Intergenic
1190062419 X:47219587-47219609 TGTCCCCCATGAACACACACCGG - Intronic
1190357612 X:49620017-49620039 TGTCCCCCGCAGGCACACACAGG + Intergenic
1191257580 X:58286275-58286297 AGTCCCCAGGGGACAGAGACAGG - Intergenic
1192282929 X:69703395-69703417 GGTCCACAGGGGACATACACCGG + Intronic
1195689317 X:107610832-107610854 TGTCCTCAGTGGACACAGTCTGG + Intergenic
1196444342 X:115737553-115737575 TCTCCCCAGGCGACACACAAGGG + Intergenic
1197963751 X:132034170-132034192 AGGCCCAAGGGGACACACACAGG + Intergenic
1200275849 X:154731632-154731654 TGTCCCTAGCGGACACCCATGGG - Intronic
1201221681 Y:11777199-11777221 TGTCTCCAGAAGACAGATACAGG + Intergenic
1201719024 Y:17077183-17077205 TGTCCTCACAGGGGACACACAGG - Intergenic