ID: 1029685572

View in Genome Browser
Species Human (GRCh38)
Location 7:102145389-102145411
Sequence TTGGCCAAAAGCCCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029685572 Original CRISPR TTGGCCAAAAGCCCCTTTGT GGG Intronic
900542203 1:3208779-3208801 TGGGCCACCATCCCCTTTGTGGG + Intronic
901053095 1:6435544-6435566 TTGACCCAAACCCTCTTTGTAGG - Intronic
902481146 1:16712505-16712527 TTGACCCAAACCCTCTTTGTAGG + Intergenic
908300204 1:62755431-62755453 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
908660081 1:66425816-66425838 TTGCCCAAAACCCCGTTGGTGGG - Intergenic
909668972 1:78166878-78166900 TTGGCCAAGAGCTTCATTGTTGG - Intergenic
910861032 1:91742470-91742492 TTGGCCAAAAGCTCATTTCCTGG - Intronic
911751204 1:101500038-101500060 TTTGCCCAAAGCCCCATTGGAGG + Intergenic
915138742 1:153752861-153752883 TTGGGCAAAATCCACTTTGGAGG + Intronic
916268953 1:162919696-162919718 TGGCCCAAGAGCCCGTTTGTGGG + Intergenic
917351210 1:174080123-174080145 TTGTCAAAAAGACCATTTGTTGG + Intergenic
917734661 1:177909421-177909443 ATCACCCAAAGCCCCTTTGTGGG - Intergenic
919139628 1:193554667-193554689 TTGGACAAAAGCACTTTTATGGG + Intergenic
921019490 1:211223355-211223377 TTTGCCCAAAGCCCCATCGTAGG + Intergenic
923998698 1:239526513-239526535 TTTGCTAGAAGCCCCTGTGTGGG + Intronic
1063859292 10:10290556-10290578 TTTGCCCAAAGCCCCATTGAGGG - Intergenic
1064603767 10:17017675-17017697 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1066614777 10:37283457-37283479 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1067079342 10:43204528-43204550 TTGGCCAAGAGCTCCATGGTGGG - Intronic
1067571747 10:47376762-47376784 TTGGCCACAGGCTCCTCTGTAGG - Intronic
1067750648 10:48969094-48969116 GTGGCCAATGGCCCCTTTGGGGG - Exonic
1068465019 10:57378468-57378490 TTGGCCATAAGCACATATGTGGG - Intergenic
1072371852 10:94772284-94772306 TTTGCCCAAAGCCCCATTTTAGG - Intronic
1072601832 10:96938329-96938351 TTGGCCAAATGCCATTTTGGAGG - Intronic
1073984402 10:109192263-109192285 TTGCCCAAAAGACCCTGTGAAGG + Intergenic
1075762084 10:124864659-124864681 TTGGCCAAAAGCCACTTGGGAGG + Intergenic
1076840812 10:133044241-133044263 TCGGCCACAAGCTCCTTGGTAGG + Intergenic
1078473749 11:11612774-11612796 CTGGCCACAAGCCTCCTTGTAGG + Intronic
1087672335 11:101122607-101122629 TTGGCCAAAAACCAGTTGGTTGG - Intronic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1096043384 12:48540412-48540434 CTGGTCATAAGACCCTTTGTGGG - Intergenic
1096230987 12:49896840-49896862 ATGGCCAGAAGCACCTTTCTGGG - Intronic
1097428126 12:59472104-59472126 TTTGCCCAAAGCCCCATTGGAGG + Intergenic
1098529553 12:71526274-71526296 TGGGTAAAAAGCCTCTTTGTAGG - Intronic
1098971521 12:76862130-76862152 TTGTCCAAAGGCCATTTTGTTGG + Intronic
1099414940 12:82373375-82373397 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1100091972 12:90983881-90983903 TTTGCCCAAAGCCCCATTGGAGG + Intronic
1100710441 12:97250477-97250499 TTGTCTTAATGCCCCTTTGTGGG - Intergenic
1107600472 13:42007243-42007265 TTGGCCAAAAGTCTCCTTGTCGG - Intergenic
1109500842 13:63234953-63234975 TTTGCCCAAAGCCCCATCGTAGG + Intergenic
1111074732 13:83218543-83218565 TTGGCCAGAGTCCCCTTTTTGGG - Intergenic
1113204116 13:107896227-107896249 TTTGCCCAAAGCCCCATCGTAGG - Intergenic
1113824932 13:113244984-113245006 TTGGCAAAAAGACTCCTTGTTGG + Exonic
1113850749 13:113416353-113416375 TTTACCAGACGCCCCTTTGTGGG - Intergenic
1114566539 14:23637344-23637366 TTTGCCCAAAGCCCAGTTGTAGG + Intronic
1114884505 14:26831714-26831736 TTCACCAAAAGCACCTTTCTTGG - Intergenic
1115285662 14:31710860-31710882 TTTTCCCAAAGCCCCATTGTAGG - Intronic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1117644547 14:57837728-57837750 TGGCACAAAAGCCCCTTTCTAGG - Intronic
1119946301 14:78698441-78698463 ATGGCCAAAGGCCTCATTGTTGG + Intronic
1122253173 14:100455063-100455085 TTGGCAATAAGCTCCTTTGATGG - Intronic
1123774856 15:23568350-23568372 TTTGTCAAAAGCCCCTTGTTGGG - Intronic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1127829998 15:62742346-62742368 TTATCCAAAGGCTCCTTTGTAGG - Intronic
1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG + Intronic
1133443398 16:5839363-5839385 TTTGCCAAAAGCCCTTTTCTTGG + Intergenic
1134091003 16:11391753-11391775 TTGGGCAGTAGCCACTTTGTGGG - Exonic
1137252336 16:46749299-46749321 TTGGGCAAATGCCCCTCTCTGGG - Intronic
1137420080 16:48325758-48325780 TTGGATAAATGCCCATTTGTGGG + Intronic
1137611435 16:49820872-49820894 TTTGCCAAAAGCCCAATTGTGGG - Intronic
1142675667 17:1511790-1511812 GTGGCCTAAAGCTGCTTTGTGGG - Intronic
1143108120 17:4539536-4539558 TTGCCCAAGACCCCCTTTTTGGG + Exonic
1143543082 17:7581043-7581065 TTGCCCAAAGACCCCTGTGTGGG - Exonic
1143937572 17:10502941-10502963 TTGCTCTAAAGCACCTTTGTTGG + Intronic
1145882865 17:28364733-28364755 TTGGCCCACAGCCCCTTCGCTGG - Intronic
1146668862 17:34723144-34723166 AGGGCCAAATGTCCCTTTGTTGG + Intergenic
1148470036 17:47887411-47887433 TTAGCAAAAAGCACCTTTGGCGG + Intergenic
1149209458 17:54287247-54287269 TTTGCCCAAAGCCCCATTGTCGG + Intergenic
1151256185 17:72878514-72878536 TTGGCCAAAAGCCGTTATGATGG - Intronic
1151325702 17:73378809-73378831 GGGGCCAAAAGCCCCTTGGAGGG + Intronic
1155440629 18:25858245-25858267 TTGGTCAAATTCTCCTTTGTAGG - Intergenic
1157835333 18:50896810-50896832 ATGGTCAAATTCCCCTTTGTAGG - Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159635893 18:70804753-70804775 TTAGGCAAAAGCACCTTTGAAGG + Intergenic
1160228200 18:77027613-77027635 GTTACCAAAAGCCCCTCTGTGGG - Intronic
1162107711 19:8380543-8380565 TTTGCCCAAAGCCCTGTTGTAGG + Intronic
1168467638 19:56616985-56617007 TTGGACAAAAGCCCCATTTGGGG + Intronic
1202715181 1_KI270714v1_random:38409-38431 TTGACCCAAACCCTCTTTGTAGG + Intergenic
925950115 2:8901715-8901737 TTTGCCCAAAGCCCCATCGTAGG - Intronic
927384811 2:22520865-22520887 TTGGCCTGAAGCCCCTTGGCTGG + Intergenic
931540267 2:63323395-63323417 TTTGCCCAAAGCCCCATCGTAGG + Intronic
932280203 2:70484832-70484854 TTGAACAAAAGCAACTTTGTTGG - Intronic
932587082 2:73037006-73037028 TTGGCCAGATGCCCCTGTGCAGG - Intronic
933754905 2:85630678-85630700 TTAACCCAAAGCCCCTTTGTAGG - Intronic
934866912 2:97822242-97822264 TTTGCCCAAAGCCCCTTCGAGGG + Intronic
938806396 2:134810328-134810350 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
940149889 2:150588288-150588310 TTGGCCAACAGCCAATTTGTAGG - Intergenic
945291937 2:208135425-208135447 CTGGCCAGGAGCCCCGTTGTCGG + Intergenic
945838798 2:214864280-214864302 TTGGACAAAAGCCACTTTAGTGG - Intergenic
946020662 2:216637732-216637754 TTGGCCAAGAGCCATTGTGTGGG - Intronic
947383433 2:229567074-229567096 TTGTGCAAAAGCCCTGTTGTTGG - Intronic
947492978 2:230611778-230611800 TAGGCCATAAACCCATTTGTGGG - Intergenic
1169647828 20:7833467-7833489 TTTGCCCAAAGCCCAATTGTAGG - Intergenic
1169689461 20:8314457-8314479 TTGGCTGAAAGCCCTTCTGTGGG - Intronic
1170487978 20:16839257-16839279 TTGGCCAAAGACCCTTTTATTGG - Intergenic
1170552120 20:17487199-17487221 TTGGCCCAAAGCCTCCTGGTTGG - Intergenic
1172157278 20:32836585-32836607 CTTGCCAAAAGCCTCTTTTTTGG + Intronic
1172301330 20:33852590-33852612 ATGGCCAAATGTCCCTTGGTAGG + Intronic
1172340442 20:34153578-34153600 TTTGCCCAAAGCCCCGTTGGGGG + Intergenic
1182872480 22:33660659-33660681 TTGGACACAATCCCCTTTGTTGG + Intronic
1183406707 22:37633721-37633743 CTGGCCACAGGCCCCTTTGCAGG - Intergenic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
952031192 3:29144590-29144612 TTGGCCAAATGCCCCATGCTTGG + Intergenic
954458658 3:50613427-50613449 TTGGCCAGAAGCCACTTTCTTGG + Intronic
961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG + Intergenic
962693743 3:137927351-137927373 TTGGCCAGAAAGCCCTGTGTTGG - Intergenic
964064285 3:152560969-152560991 TTTGCCCAAAGCCCCATCGTAGG + Intergenic
964394244 3:156228837-156228859 ATGGCCACATGGCCCTTTGTAGG + Intronic
964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG + Intronic
967573281 3:191057654-191057676 TTGACCAAAATCTCCTTTATAGG - Intergenic
967705348 3:192643370-192643392 TTGGACAAAATCCCCTTTGGTGG - Intronic
969211838 4:5693698-5693720 ATGGCCAAGAGCCCTTTTTTGGG - Intronic
974526344 4:63054013-63054035 TTTGCCCAAAGCCCCATCGTAGG + Intergenic
975047785 4:69826002-69826024 TTTGCCCAAAGCCCCATTGTAGG + Intronic
980677880 4:136113744-136113766 TTGGCTAAAAGCCTTTTTATTGG - Intergenic
983835152 4:172376090-172376112 TTTGCCCAAAGCCCTGTTGTAGG - Intronic
985047272 4:185952959-185952981 TTGGCCCACAGCCCACTTGTAGG + Intronic
985550405 5:530520-530542 TTTGGCAAAAGGCGCTTTGTAGG + Intergenic
987545470 5:19306301-19306323 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
989377016 5:40774773-40774795 GTATGCAAAAGCCCCTTTGTGGG - Intronic
992673629 5:79083764-79083786 GTGGCAAAAAGCCCCTTTCTGGG - Exonic
992678328 5:79127891-79127913 GTGGCAAAAAGCCCCTTTCTGGG - Exonic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
995112823 5:108446358-108446380 TTTCCCCAAAGCCCCTCTGTGGG - Intergenic
995583656 5:113624799-113624821 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
997072174 5:130634680-130634702 TTTGCCAAAAGCCCCATCGTAGG + Intergenic
998111233 5:139504385-139504407 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1001338991 5:170826353-170826375 TTGGCCAGAAGCCCCTCTCAGGG - Intergenic
1002187403 5:177460739-177460761 AAGGCCAAAAGCCCCTGTGGGGG - Intronic
1003317316 6:5024408-5024430 CCGGCCAAAGGCCCCTTTGAAGG + Intergenic
1006595818 6:35192051-35192073 GTGGCCACAAGCCACTTTGACGG - Intergenic
1008439879 6:51520744-51520766 TTGGCCAAAAGCCCCATTAAAGG + Intergenic
1010074734 6:71786721-71786743 TTTGCCCAAAGCTCCATTGTAGG + Intergenic
1012441766 6:99267550-99267572 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1013293616 6:108739587-108739609 TTGGCCAAATGCCTATCTGTTGG + Intergenic
1017737641 6:157379979-157380001 TTCCCCACAACCCCCTTTGTTGG + Intergenic
1018497005 6:164359099-164359121 TTGACCTTAACCCCCTTTGTGGG + Intergenic
1018613692 6:165664915-165664937 TTGCCCATAAGCCCCCTTGCGGG + Intronic
1021756959 7:23860993-23861015 TTTGCCCAAAGCCCCATTATAGG - Intergenic
1023151280 7:37203516-37203538 TTTGCCCAAAGCCCCATTGTAGG - Intronic
1024281215 7:47721365-47721387 ATTGCCAAATGTCCCTTTGTGGG + Intronic
1024298503 7:47865387-47865409 TTGGCCAAAAGACCAATTGGAGG + Intronic
1024735054 7:52295977-52295999 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1025863863 7:65361533-65361555 TAGACCAAAAGCACCTTTGTGGG + Intergenic
1028495460 7:91455327-91455349 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1029611266 7:101627765-101627787 TTGGCCAAATGCCCCTTCCTGGG - Intronic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1032519868 7:132535713-132535735 TTGGCCAAGATCCCCTCTGCAGG + Intronic
1039449260 8:37658603-37658625 TTGGCATGAAGCCCCTCTGTTGG - Intergenic
1039693407 8:39884327-39884349 TTTGCCCAAAGCCTCATTGTAGG - Intergenic
1040965305 8:53076013-53076035 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1041001668 8:53460667-53460689 TTTGCCAAAAACCCCATTGTAGG + Intergenic
1042771687 8:72389139-72389161 TTGGCCCAAAGCCCCATGGTGGG + Intergenic
1044640463 8:94375099-94375121 ATTGCCAAAATGCCCTTTGTTGG - Intronic
1049229982 8:141476948-141476970 TTGCCCAAAAGTCCCCTTTTAGG + Intergenic
1051935023 9:22435622-22435644 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1052058022 9:23924791-23924813 TTTGCCCAAAGCCCCGTTGTAGG - Intergenic
1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG + Intergenic
1057519444 9:95749909-95749931 TTGGCCAAAAAACCTTTTCTTGG - Intergenic
1058339975 9:103882885-103882907 TTGGCAAAAAGACACTTGGTAGG - Intergenic
1059015493 9:110511036-110511058 TTAGCCTTAGGCCCCTTTGTTGG - Intronic
1059511124 9:114848418-114848440 TTGGCCAATAGGTCCTTAGTTGG - Intergenic
1187380779 X:18799876-18799898 TTGCATAAAAGCCCATTTGTTGG - Intronic
1188196785 X:27244496-27244518 TTGGCCAAAAGCCCCTTCTAAGG + Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190925341 X:54898703-54898725 TTGGACAACATCCACTTTGTTGG - Intergenic
1192410581 X:70929570-70929592 CTGACCAAAAACCCCTTTGCTGG + Intronic
1195552633 X:106185934-106185956 TTTGCCCAAAGCCCCATGGTGGG - Intronic
1195952992 X:110297172-110297194 TTTGCCAAAAAGCCCTGTGTTGG + Intronic
1195953268 X:110301288-110301310 TTTGCCAAAGGGCCCTGTGTTGG + Intronic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200881019 Y:8211217-8211239 TTTGCCCAAAGCCCCATTGTAGG - Intergenic
1201403545 Y:13628915-13628937 TTTGCCCAAAGCCCCATTGTAGG + Intergenic
1201568799 Y:15392657-15392679 TTTGCCCAGAGCCCCATTGTAGG - Intergenic
1202242647 Y:22787236-22787258 TTTGCCCAAAGCCCCATTGCAGG + Intergenic
1202395634 Y:24420986-24421008 TTTGCCCAAAGCCCCATTGCAGG + Intergenic
1202475151 Y:25249106-25249128 TTTGCCCAAAGCCCCATTGCAGG - Intergenic