ID: 1029686141

View in Genome Browser
Species Human (GRCh38)
Location 7:102149487-102149509
Sequence GGGCAATGGCGTAGTGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029686141_1029686143 -10 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686143 7:102149500-102149522 GCCATTGCCCACTCCTCCCCTGG No data
1029686141_1029686153 9 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686153 7:102149519-102149541 CTGGGACATTTGTTTCCCTTGGG 0: 1
1: 0
2: 2
3: 31
4: 269
1029686141_1029686155 21 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686155 7:102149531-102149553 TTTCCCTTGGGTGTGGTTCATGG 0: 1
1: 0
2: 0
3: 23
4: 221
1029686141_1029686152 8 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686152 7:102149518-102149540 CCTGGGACATTTGTTTCCCTTGG No data
1029686141_1029686145 -9 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686145 7:102149501-102149523 CCATTGCCCACTCCTCCCCTGGG 0: 1
1: 0
2: 3
3: 40
4: 329
1029686141_1029686154 14 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686154 7:102149524-102149546 ACATTTGTTTCCCTTGGGTGTGG 0: 1
1: 0
2: 2
3: 19
4: 221
1029686141_1029686158 25 Left 1029686141 7:102149487-102149509 CCAGCGCCACTACGCCATTGCCC 0: 1
1: 0
2: 2
3: 2
4: 57
Right 1029686158 7:102149535-102149557 CCTTGGGTGTGGTTCATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029686141 Original CRISPR GGGCAATGGCGTAGTGGCGC TGG (reversed) Intronic
900533804 1:3167542-3167564 GGGCAATGCCACAGAGGCGCTGG - Intronic
900533863 1:3167721-3167743 GGGCAATGTCACAGAGGCGCTGG - Intronic
900533883 1:3167781-3167803 GGGCAATGTCACAGAGGCGCTGG - Intronic
900533943 1:3167957-3167979 GGGCAATGTCACAGAGGCGCTGG - Intronic
900533983 1:3168075-3168097 GGGCAATGTCACAGAGGCGCTGG - Intronic
906290563 1:44617082-44617104 GGGCATGGGCGTAGGGGTGCTGG - Intronic
915185208 1:154099200-154099222 TGGCAAGGGGGTAGTGGGGCTGG + Intronic
919640620 1:200041063-200041085 GGGCATCGGGGAAGTGGCGCTGG + Intronic
1063961249 10:11307172-11307194 GGGCAAGGGAGAAGAGGCGCTGG - Intronic
1067369762 10:45672556-45672578 GCGCAAGGCCGGAGTGGCGCGGG - Intronic
1070109415 10:73469259-73469281 GGGCAGGGGCGCAGTGGCTCAGG + Intronic
1070149619 10:73797752-73797774 GGGCAATGGGGTAGGGACGGGGG - Intronic
1071529312 10:86377044-86377066 GGGCAATTGCGCGGTGGCTCAGG - Intergenic
1085034779 11:73293293-73293315 GGGCAAGGGCAGAGTGGCCCTGG + Intronic
1089311934 11:117564003-117564025 TGCCAAGGGCGTAGTGGCCCAGG + Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094672901 12:32588090-32588112 GGGGAATGGGGTAGGGGTGCAGG + Intronic
1114624998 14:24123254-24123276 GGGCACTGGGGCAGGGGCGCTGG - Exonic
1129672346 15:77614254-77614276 GGGGAAAGGCACAGTGGCGCGGG + Exonic
1131085430 15:89572123-89572145 GGGCAGTGGGGCAGTGGGGCTGG - Intergenic
1134107463 16:11494386-11494408 GGGCAGTGGCGTGGGGGGGCAGG + Intronic
1136014750 16:27389021-27389043 GGGGAATGGAGAAGTGGGGCAGG - Intergenic
1148337457 17:46851391-46851413 GGGCAATGGGGGAGGGGCGGGGG + Intronic
1148899710 17:50866520-50866542 GGCCAATGGCGTCGGGGGGCAGG - Intronic
1150294551 17:64001007-64001029 GGGGAATGGAGGAGTGGCGGTGG + Intronic
1154313119 18:13282768-13282790 GGGGCATGGCCTAGTGGAGCTGG - Intronic
1155920494 18:31598594-31598616 CGGCAATGGTGTAGCGGCGGGGG - Exonic
1157328479 18:46686130-46686152 GGGCCATGGGGTAGTGGCAAGGG + Intronic
1160454174 18:78986298-78986320 GGGCCATGGCGTCGACGCGCGGG + Intronic
1163666796 19:18607170-18607192 GGGGAATGGAGGAGTGGGGCAGG - Intronic
1168434847 19:56308669-56308691 GTGCAATGGCATAATGGAGCGGG - Intronic
1168641710 19:58035162-58035184 GGGCAATGCTGTGGTGGCCCTGG - Intronic
1168706944 19:58475777-58475799 GGGGAATGGCGTGGGGGCGGCGG + Intronic
925005723 2:441666-441688 GGGCAAGCGCGTGGTGGAGCAGG + Intergenic
926599894 2:14830998-14831020 GGGCAATGGTGTCCTGGGGCTGG - Intergenic
937895963 2:126977009-126977031 GGGCAGTGGCGGGGTGGTGCTGG - Intergenic
1175429797 20:58892535-58892557 GCGCAAGGGAGTCGTGGCGCCGG + Intronic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1178914072 21:36697403-36697425 GGGCCATGGGCTAGCGGCGCGGG - Intergenic
1179451450 21:41471092-41471114 GAGCAATGGCGTGGTGCCTCTGG - Intronic
1179514381 21:41896937-41896959 GGTCAATGAGGTAGGGGCGCAGG + Intronic
1181085440 22:20437515-20437537 GGGCAGTGGTGTGGCGGCGCCGG - Intronic
1182866733 22:33610818-33610840 GGGCAATGGTGTCCTGGCCCTGG - Intronic
953869887 3:46617441-46617463 GGGCAATTGCGTGGGGGCTCAGG - Intronic
967903921 3:194486250-194486272 GGGCAGAGGCGTAGGGGTGCTGG - Intronic
968691275 4:1991734-1991756 GGGCAGGGGCATGGTGGCGCCGG - Intronic
972770052 4:42189352-42189374 GGGCAAAGGCGAAGTGAGGCTGG + Intergenic
986475269 5:8123715-8123737 GAGCAATGGCATAGTGCAGCAGG + Intergenic
992084967 5:73270140-73270162 GGGCAATGCCAGAGTGGAGCGGG - Intergenic
997773385 5:136575226-136575248 GGACAATGGCGTAGTGGTGCAGG + Intergenic
1017834917 6:158168326-158168348 GCGCGATGGCGTATCGGCGCAGG + Intergenic
1026863616 7:73809757-73809779 GGGCAATGGCGGAATGGTGGGGG - Intronic
1029290450 7:99498627-99498649 TGGGAATGGCATAGTGGCTCAGG + Intronic
1029686141 7:102149487-102149509 GGGCAATGGCGTAGTGGCGCTGG - Intronic
1031571845 7:123369239-123369261 GGGTAATGGGGTAGTGGTGGAGG - Intergenic
1031901766 7:127418642-127418664 TGGCAATGGTGTAGTGGTGCTGG - Intronic
1034350836 7:150413823-150413845 GGGCAATGGCAAAGTGGCGCTGG - Intergenic
1037689751 8:21171976-21171998 GGGGAATGGGGCAGTGGAGCTGG - Intergenic
1052353641 9:27482619-27482641 GGGCAATGGTGTAGAGGCAGAGG - Intronic
1052892968 9:33720601-33720623 GGGCATTGGTGCAGTGGAGCTGG - Intergenic
1062718482 9:138022911-138022933 CAGCAATGGAGTAATGGCGCAGG - Intronic
1198394735 X:136209557-136209579 GGGCAATAGCGTGGTGGCATGGG + Intronic