ID: 1029686698

View in Genome Browser
Species Human (GRCh38)
Location 7:102153407-102153429
Sequence GCTGGAGGCGTGGCTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029686698_1029686710 20 Left 1029686698 7:102153407-102153429 CCCCAGGCAGCCACGCCTCCAGC No data
Right 1029686710 7:102153450-102153472 AGATCAGGGAGCTGCACCCAGGG No data
1029686698_1029686704 5 Left 1029686698 7:102153407-102153429 CCCCAGGCAGCCACGCCTCCAGC No data
Right 1029686704 7:102153435-102153457 AGCTCCGCACTCCCAAGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 99
1029686698_1029686705 6 Left 1029686698 7:102153407-102153429 CCCCAGGCAGCCACGCCTCCAGC No data
Right 1029686705 7:102153436-102153458 GCTCCGCACTCCCAAGATCAGGG 0: 1
1: 0
2: 0
3: 2
4: 142
1029686698_1029686711 26 Left 1029686698 7:102153407-102153429 CCCCAGGCAGCCACGCCTCCAGC No data
Right 1029686711 7:102153456-102153478 GGGAGCTGCACCCAGGGAGACGG No data
1029686698_1029686709 19 Left 1029686698 7:102153407-102153429 CCCCAGGCAGCCACGCCTCCAGC No data
Right 1029686709 7:102153449-102153471 AAGATCAGGGAGCTGCACCCAGG 0: 1
1: 0
2: 2
3: 13
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029686698 Original CRISPR GCTGGAGGCGTGGCTGCCTG GGG (reversed) Intronic