ID: 1029687512

View in Genome Browser
Species Human (GRCh38)
Location 7:102158882-102158904
Sequence GGGTGTTTAGAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029687512_1029687515 -7 Left 1029687512 7:102158882-102158904 CCCTACTCCATCTCTAAACACCC 0: 1
1: 0
2: 3
3: 13
4: 265
Right 1029687515 7:102158898-102158920 AACACCCGTCTTTGTAGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1029687512_1029687519 24 Left 1029687512 7:102158882-102158904 CCCTACTCCATCTCTAAACACCC 0: 1
1: 0
2: 3
3: 13
4: 265
Right 1029687519 7:102158929-102158951 ACAGTGTAGACATCTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029687512 Original CRISPR GGGTGTTTAGAGATGGAGTA GGG (reversed) Intronic
900486027 1:2923197-2923219 GGGTCCTGAGAGATGGAGCACGG - Intergenic
901086875 1:6615760-6615782 GGGTGTTTCTAGATGGAATGGGG + Intronic
901254902 1:7815108-7815130 GTATTTTTAGAGATGAAGTATGG - Intronic
901295113 1:8155498-8155520 GGCTCTTTAAAGATGGAGTGAGG - Intergenic
902424735 1:16310960-16310982 GTTTGTTTTGAGATGGAGTCCGG - Intronic
903548307 1:24140953-24140975 TTGTGTGTAGAGTTGGAGTAGGG - Intronic
904006050 1:27363889-27363911 TGGTGTTCAGAGAGGCAGTAGGG - Intronic
904043127 1:27595486-27595508 GGGTGTTTAGGGATGTATTGGGG + Intronic
904902166 1:33866034-33866056 GGGTCCTTAGAGGTGGAGTTAGG - Intronic
905249334 1:36638000-36638022 GGATGGTCAGAGATGGAGTGTGG - Intergenic
905568073 1:38981815-38981837 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
905930810 1:41786035-41786057 GGGTGTTGGGAGATGTAGTGAGG + Intronic
906712817 1:47944192-47944214 GGGTGTGGAGAGAGGGAGCAGGG + Intronic
908625879 1:66041103-66041125 TGTTGTATAGAGGTGGAGTAGGG + Intronic
908952002 1:69570833-69570855 GTGTGTTTAGTGATTGAGTTTGG + Intronic
912340375 1:108908706-108908728 TTGTGTTTTGAGATGGAGTCTGG - Intronic
912667500 1:111595660-111595682 GTGTGTTTAGAGCTGCAGTTAGG + Intronic
912760202 1:112359663-112359685 TGGTGTTCAGTGATGGAGGAGGG + Intergenic
915820490 1:159018104-159018126 AGATGTTTAGAGCTGGAGTCAGG - Intronic
915947123 1:160161480-160161502 GTGTGTCTAGAGATGGGGTTGGG - Intronic
916143008 1:161715822-161715844 GGGAGGTTGGAGAGGGAGTAGGG + Intergenic
917731444 1:177878910-177878932 GGGTGTTTAGATATGGGTTTGGG + Intergenic
918254849 1:182739950-182739972 GGGTGTTGGGAGCTGGAGCATGG - Intergenic
919673453 1:200358544-200358566 GGTTGTTTAGGGCTGTAGTAGGG - Intergenic
920692624 1:208158623-208158645 GTGGGATTAGAGATGGAGTTGGG - Intronic
923514343 1:234681894-234681916 GGGTATTTAGAGAGGGTGGAGGG + Intergenic
924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG + Intergenic
924841837 1:247719338-247719360 GGTTGTTTAGAGATAGAAAATGG - Intergenic
1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG + Intergenic
1069817376 10:71207015-71207037 GGGTACTTAGGGATGGAGGAAGG - Intergenic
1069850740 10:71403108-71403130 GGTTCTTTTGAGATGGAGTCTGG - Intronic
1071483179 10:86080030-86080052 GGCTGTTAAGAAACGGAGTAAGG + Intronic
1071614926 10:87066585-87066607 GGGTGTGTGGACATGGACTAGGG - Intronic
1071771420 10:88733145-88733167 GGGCATTTAGTGATGGAGGAGGG - Intronic
1074699389 10:116079888-116079910 GGGGGTTTTGAAATGGAGTTTGG - Intronic
1074866315 10:117546171-117546193 GGGTGTTTGGAGCTGGAGGCTGG + Intronic
1074930771 10:118123563-118123585 GGGAGTTTTGAGATGGAGGGAGG + Intergenic
1075223603 10:120605126-120605148 GGGTGTTTGGGGATGGAGGGTGG + Intergenic
1075407936 10:122206985-122207007 GGATGTTTAGAAATCCAGTAGGG + Intronic
1077346903 11:2064164-2064186 TGGAGTATAGAGATGGAGAATGG - Intergenic
1080712211 11:34759609-34759631 GATTGTTTAGAGATGGAGTAGGG + Intergenic
1082824259 11:57566804-57566826 GGGTGTTTGGAGATGGATTAGGG - Intronic
1086349628 11:85932607-85932629 GTTTATTTAGAGATGGAGTCTGG + Intergenic
1087074564 11:94117346-94117368 GTGTGTGTAGAGATAGAGTCTGG + Intergenic
1087561580 11:99796839-99796861 AGCTGCTTAGAGATGTAGTAGGG - Intronic
1090079767 11:123604164-123604186 GGGCATTTAGATATGGAGTGTGG + Intronic
1092498451 12:9022126-9022148 GGTTTTTTAGAGATGGGGTCTGG - Intergenic
1093553715 12:20446349-20446371 GAGTGTTTTGAGATGGGGTGAGG + Intronic
1093701456 12:22226957-22226979 TGTTGTTTTGAGATGGAGTCTGG + Intronic
1096898874 12:54853624-54853646 GAGAGTTTAGAGATGGAAAATGG - Intronic
1097383845 12:58925897-58925919 GGGAGTCTGGAGATGGGGTAGGG + Intergenic
1098878010 12:75887182-75887204 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1099518310 12:83626890-83626912 AGGTGTATATAGATGAAGTATGG - Intergenic
1099743362 12:86669554-86669576 GTGTGTTTAGTCATGGAGTTGGG - Intronic
1099813578 12:87617781-87617803 CTTTGTTTAGAGATTGAGTATGG - Intergenic
1100683582 12:96959366-96959388 GGGCGTTTGGTGGTGGAGTAGGG + Intergenic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1103144221 12:118580440-118580462 GGGTCTTTAAAGAGGGATTAAGG + Intergenic
1103200864 12:119086893-119086915 TGGTGTTTAGAGTTGGGGTTTGG - Intronic
1104390989 12:128390477-128390499 GGGTTCTTAGAGGTGGAGGAGGG - Intronic
1106581746 13:31024806-31024828 GGCTGTTTAGTGCTGGAGTCTGG + Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107899459 13:44997546-44997568 GAGTTTTTGGAGCTGGAGTAGGG - Intronic
1108004632 13:45934451-45934473 TGGTGTGTATAGATGGAGTGGGG + Intergenic
1109974028 13:69807607-69807629 GAGTGTTTAGAGATGTTGTTTGG + Intronic
1110468363 13:75828817-75828839 GGGTGATTCAAGATGGATTATGG + Intronic
1112103427 13:96215062-96215084 GGGTGTTTAGAAATGAAGCAAGG + Intronic
1113088545 13:106593206-106593228 GGGAGTTCTGAGATGGAGTGAGG - Intergenic
1117017709 14:51535364-51535386 GGTTGTTTAGGGATGGGGTGAGG - Intronic
1117399963 14:55349971-55349993 GGGTGTTTAAAAATCTAGTAGGG + Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1119846132 14:77831496-77831518 GGGTGTTTTGGGTTGGAGTATGG + Intronic
1120025665 14:79581270-79581292 GAGTGTTGAGAGAAGCAGTAAGG - Intronic
1121323298 14:93005361-93005383 GGGTGGTCAGACATGGAGTGCGG + Intronic
1121403362 14:93702348-93702370 CTGTGTTTATAAATGGAGTATGG - Intronic
1121697998 14:95928500-95928522 TGGTGTTTAGAGGAGGAGGAAGG - Intergenic
1130613883 15:85385835-85385857 GTTTGTTTCGAGATGGAGTTTGG + Intronic
1130664628 15:85859482-85859504 GTGAGTTTAGAGATGGTATATGG - Intergenic
1130686126 15:86039406-86039428 GGGTGATAAGATATGGAGGATGG - Intergenic
1130857270 15:87851599-87851621 TGCTGTTAAGAGATGGAGTTGGG - Intergenic
1131251467 15:90833491-90833513 GTTTGTTTCGAGATGGAGTCTGG + Intergenic
1131323446 15:91420399-91420421 GTGTGTTTAGAGATGCCATATGG + Intergenic
1132341389 15:101080495-101080517 TTGTGTTTTGAGATGGAGTCTGG + Intergenic
1133728190 16:8556510-8556532 TGTTGTTTTGAGATGGAGTTTGG + Intergenic
1136449609 16:30346318-30346340 GTGTGTGTAGAGATGGAGTCTGG + Intergenic
1136717693 16:32297540-32297562 TGTTGTTTTGAGATGGAGTCTGG + Intergenic
1136836069 16:33503812-33503834 TGTTGTTTTGAGATGGAGTCTGG + Intergenic
1137598956 16:49743444-49743466 GGGTGCTGAGAGGTGGAGAAGGG - Intronic
1138108346 16:54303852-54303874 GTGTGTTGAGCGATGGGGTAGGG + Intergenic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1139647866 16:68344919-68344941 GTGTGTGTAGAGATGCAGGAAGG - Intronic
1140192287 16:72828442-72828464 TGGTGTTGAGAGAAGGAGAACGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141568325 16:84918451-84918473 GGGTGTTCAGAGATGCATCATGG + Intronic
1203008735 16_KI270728v1_random:220224-220246 TGTTGTTTTGAGATGGAGTCTGG - Intergenic
1203146246 16_KI270728v1_random:1804102-1804124 TGTTGTTTTGAGATGGAGTCTGG + Intergenic
1143351165 17:6289241-6289263 GGGTGGTAAGTGATGGAGCAGGG + Intergenic
1146639819 17:34531841-34531863 GTGTGTGTATAGATGGAGTGAGG - Intergenic
1147556902 17:41485531-41485553 GGGTGCTCAGACATGGAGTCTGG - Intergenic
1148290484 17:46444016-46444038 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1148312652 17:46661589-46661611 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1148561356 17:48608569-48608591 GGGAGTTTGCAGCTGGAGTAAGG - Intronic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1152233537 17:79126575-79126597 GGGTGTATAGACAGGGAGGAGGG - Intronic
1157258690 18:46160419-46160441 CGTTGTTAAGACATGGAGTATGG + Intergenic
1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1161237924 19:3207118-3207140 GGGTTTGTAGAGATGGAGACTGG - Intronic
1162045443 19:7996799-7996821 TGGTTTTTGGAGATGGAGTCTGG - Intronic
1162325246 19:9995513-9995535 GGGTGTTGAGGGATGGATAAGGG + Intronic
1162617822 19:11815883-11815905 TGTTGTTTTGAGATGGAGTCTGG - Intronic
1166666034 19:44680975-44680997 GAGTGTTTAGGGCTGGAGTCGGG - Intronic
1167763410 19:51463217-51463239 GGGTGATTAGGGGTGGAGTGTGG + Intergenic
1168498201 19:56871773-56871795 GTTTGTTTTGAGATGGAGTTTGG - Intergenic
927141185 2:20131885-20131907 GGGTGTTTAGAGTCAGAGTCCGG - Intergenic
927375969 2:22414833-22414855 TGCTGTTGGGAGATGGAGTATGG - Intergenic
927784200 2:25961237-25961259 GGGAGTGAAGAGATGGAGAAAGG + Intronic
929148996 2:38731213-38731235 GTTTGTTTTGAGATGGAGTCTGG - Intronic
929845868 2:45526429-45526451 GGTTGCTTAGGGCTGGAGTAGGG + Intronic
931391919 2:61851778-61851800 GGGTGTATAGGGATGGTGCAGGG + Intronic
933255314 2:80073979-80074001 GGGTATGTAGTGATGGAGTCTGG + Intronic
935018832 2:99211371-99211393 GGCTGTCTAGAGTTGGAGAATGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937017153 2:118616652-118616674 GGGGGTGTAGAGCTGGAGCAGGG + Intergenic
937378817 2:121357046-121357068 GGGTTTTTAGAGATGGATACCGG - Intronic
937390102 2:121478587-121478609 GTGTGTTTTGAGACGGAGTCTGG - Intronic
941454506 2:165699117-165699139 GGGTGTTTAGAGTCTGCGTATGG + Intergenic
941475825 2:165951068-165951090 GGGGGTCTGGAGATGGGGTATGG - Intronic
942115420 2:172724555-172724577 GTGAGTTTAGACATGGAGTCTGG + Intergenic
944687548 2:202131148-202131170 GTTTGTTTTGAGATGGAGTCTGG + Intronic
945111863 2:206367634-206367656 GGGTGTGTACAGATGGAATTTGG - Intergenic
947807036 2:232976187-232976209 GGTTTTTTTGAGATGGAGTCTGG - Intronic
948761671 2:240196047-240196069 GTTTGTTTAGAGATTGAGTTGGG - Intergenic
949048568 2:241884358-241884380 GGGTGTCTGTAGATGGAGTTGGG + Intergenic
1169059087 20:2647968-2647990 GGTCATTTAGAGATGGAGGATGG - Intergenic
1170356280 20:15495529-15495551 GGGTGTTTAGCCTTAGAGTATGG - Intronic
1170770273 20:19326506-19326528 GGGTGTGTAGAGCTGGATCAGGG + Intronic
1172919801 20:38472036-38472058 GGGTATTGAGAGAGGGAGGAGGG - Intergenic
1173017934 20:39243838-39243860 GGGTGAGGAGAGATGGAGTGTGG + Intergenic
1173751807 20:45482289-45482311 GGGCATTAAGAGAGGGAGTATGG - Intergenic
1173901035 20:46589015-46589037 GGGAGCCTAGAGATGGAGGATGG - Intronic
1174474074 20:50783536-50783558 GAGGGTTTAGAGGTGGAGGAAGG - Intergenic
1174724361 20:52845718-52845740 GGGGATTAAGAGATGGAGTTTGG - Intergenic
1175157270 20:56979606-56979628 GTTTGTTTTGAGATGGAGTCCGG + Intergenic
1182461881 22:30489249-30489271 GTTTGTTTAGAGACGGAGTCTGG + Exonic
1182844219 22:33417338-33417360 TGGTGATTAGAAATGGAGAAGGG - Intronic
1183481311 22:38067029-38067051 GGGTGTTTTGGGGTGGAGGAGGG + Intronic
1184873680 22:47258625-47258647 TGGTGGTGAGTGATGGAGTAGGG - Intergenic
1185059326 22:48597852-48597874 GGGAGTTAAGGGATGGAGAAGGG + Intronic
950339940 3:12234260-12234282 GGGTGCTTGGAGATGGAGGGAGG - Intergenic
950836050 3:15920032-15920054 GGGGGTTTTGAGATGGAGTAAGG + Intergenic
951622373 3:24617102-24617124 AGTTGTTCAGAGATGGGGTAAGG + Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG + Intronic
953974972 3:47375570-47375592 GGGTGGTTGCAGATGGAGTTGGG - Intergenic
957198830 3:77106052-77106074 GTTTGTTTTGAGATGGAGTCTGG + Intronic
959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG + Intergenic
960510911 3:118547844-118547866 GGGTGTGTGGTGATGGAGTGGGG + Intergenic
960619327 3:119623660-119623682 GGGTGTGTGGAGAGGGAGCAGGG + Intronic
960775434 3:121246291-121246313 GGGTGGTGAGAGATGGATTCGGG - Intronic
961307150 3:125966240-125966262 TGGTGTTTAGGGAAGGATTAGGG + Intergenic
961494958 3:127284655-127284677 GAGTGTAAGGAGATGGAGTAGGG + Intergenic
961986758 3:131142628-131142650 GGATGTTTGGAGTTGGGGTAGGG - Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
965363468 3:167769004-167769026 GTTTGTTTTGAGATGGAGTGTGG + Intronic
969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG + Intronic
969897059 4:10315314-10315336 AAGTGTCTAGAGATGGAGTCAGG + Intergenic
972373735 4:38450689-38450711 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
976795367 4:88926035-88926057 GGGTGATAAGAGAGGGAGGAAGG + Intronic
977297464 4:95226795-95226817 GGGTGTTTGGAAATGGGGTAGGG + Intronic
978631208 4:110747488-110747510 GGGTGTTCACAGTTGGAGAATGG + Intergenic
979689207 4:123542902-123542924 GGGTGGTCAGACATGGAGGATGG - Intergenic
980088423 4:128416349-128416371 GGGAGTTTAGAGATGTCGTTTGG - Intergenic
981541896 4:145854604-145854626 GAGTGCTCAGAGATGAAGTAGGG - Intronic
982230828 4:153206702-153206724 GGGTGTGTATGGGTGGAGTAGGG + Intronic
986843620 5:11727272-11727294 GGGTGTTTAGAGTTCCAGGAGGG - Intronic
987207880 5:15646002-15646024 GGGTGGGTAGAGTTGGAGGAGGG + Intronic
987699829 5:21382819-21382841 GGGGGTTTAGAGATACAGGAAGG - Intergenic
987924987 5:24329477-24329499 GGGTGATAATAGCTGGAGTAGGG - Intergenic
988292371 5:29304866-29304888 TTGTGTATAGAGATGGAGTCAGG + Intergenic
988567686 5:32332763-32332785 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
988752574 5:34205236-34205258 GGGGGTTTAGAGATACAGGAAGG + Intergenic
988798406 5:34673859-34673881 GGGTTTTTAGAGTTGGGGGAGGG - Intronic
989142426 5:38214781-38214803 GGGTGACAGGAGATGGAGTATGG + Intergenic
990768450 5:59214720-59214742 AGTTGTTTAGAGATGAAGAAGGG + Intronic
991740341 5:69666050-69666072 GGGGGTTTAGAGATACAGGAAGG + Intergenic
991757157 5:69887117-69887139 GGGGGTTTAGAGATACAGGAAGG - Intergenic
991791916 5:70245791-70245813 GGGGGTTTAGAGATACAGGAAGG + Intergenic
991819804 5:70542167-70542189 GGGGGTTTAGAGATACAGGAAGG + Intergenic
991836560 5:70762999-70763021 GGGGGTTTAGAGATACAGGAAGG - Intergenic
991884365 5:71246129-71246151 GGGGGTTTAGAGATACAGGAAGG + Intergenic
992869897 5:80995306-80995328 GGTTGCTTAGAGCTGGAGTTAGG - Intronic
994176533 5:96717995-96718017 AGGTGATTAGACCTGGAGTAGGG + Intronic
994717905 5:103346205-103346227 TGGTGTTAAGGTATGGAGTAGGG + Intergenic
994804659 5:104428673-104428695 GGGTGTTTAGAAATGATGCATGG + Intergenic
996304617 5:122032962-122032984 GTTTGTTTTGAGATGGAGTCTGG + Intronic
996549003 5:124710835-124710857 GCATGTATAGAGATGGTGTATGG - Intronic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
997515928 5:134489966-134489988 GGATTTCTAGAGATGGGGTAGGG - Intergenic
999194887 5:149775084-149775106 GGTTGTGTAGGGGTGGAGTAGGG + Intronic
1000097461 5:157984483-157984505 GGGTGATTAGACATGCAGGATGG + Intergenic
1003533511 6:6956600-6956622 GGGTGTTTGGTGATGCAGTGGGG - Intergenic
1005550736 6:26911956-26911978 GGGGGTTTAGAGATACAGGAAGG + Intergenic
1005860207 6:29894665-29894687 GTTCGTTTTGAGATGGAGTATGG - Intergenic
1006021024 6:31117642-31117664 GAGAGTTTAGGGATGGAGAAAGG + Intronic
1007360429 6:41351612-41351634 GGGTGAGTAGAGATGGGGCAGGG - Intergenic
1007447164 6:41915773-41915795 GTGTGTTTTGAGACGGAGTCTGG - Intronic
1009696342 6:67108873-67108895 GGGTGTGTGGAGAGGAAGTAGGG + Intergenic
1010255659 6:73754403-73754425 TGGTGTTTAGAGACTGAGTGAGG + Intronic
1010911143 6:81558327-81558349 GGGTGATTAGTGATGGGGCATGG + Intronic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1012411407 6:98962091-98962113 TGGTGATTAGAGAGGGATTATGG + Intergenic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1013958604 6:115870228-115870250 TCATCTTTAGAGATGGAGTAGGG - Intergenic
1014028108 6:116672009-116672031 GAGTGTATTAAGATGGAGTAGGG - Intergenic
1018067980 6:160137018-160137040 GGGTGTTTAGATATGAGGAATGG - Intronic
1020736382 7:11954059-11954081 GAGTTTTAAGAGTTGGAGTAGGG + Intergenic
1020806730 7:12799237-12799259 AGGTGTATAGAGATAGAGCAGGG - Intergenic
1021083674 7:16393558-16393580 TGGAGTTTACAGATTGAGTAGGG - Intronic
1022470176 7:30677147-30677169 GTGGGTTTGGAGATGGAGTCGGG + Intronic
1023368174 7:39486045-39486067 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1024572214 7:50732686-50732708 GGGTGTTAATAGATGGTATAGGG - Intronic
1024572420 7:50734294-50734316 GAGTGTTTAGAGATGGGGCTAGG - Intronic
1026905375 7:74060099-74060121 GGGGGATTAGAGATGGAGGCGGG - Intronic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1029865716 7:103625965-103625987 CAGTGGTTAGAGTTGGAGTAAGG + Intronic
1031087730 7:117320492-117320514 GGGTCTTTGAAGATGGAGTGAGG + Intronic
1031294259 7:119982807-119982829 AGCTGCTTAGAGAGGGAGTAGGG + Intergenic
1032258512 7:130315792-130315814 GGGGGTTTAGTGTTGGAATAAGG + Intronic
1032283679 7:130525791-130525813 GGGTGTTTGGTGCTGGAGTGTGG + Intronic
1032450487 7:132026171-132026193 GGCTGTGTAGAGCTGGGGTAGGG + Intergenic
1033341100 7:140492966-140492988 GGGAGCTTAGAGATAGGGTAAGG - Intergenic
1034258017 7:149735019-149735041 GGGTGTTTAGAGAGGTAATCAGG - Intergenic
1037520295 8:19674506-19674528 GGGTGTTTAGAGCCAGAGGAGGG + Intronic
1038384735 8:27132312-27132334 GGGTATTTAGTGATAGGGTAAGG + Intergenic
1039790390 8:40871364-40871386 GAGTGGGTAGGGATGGAGTAGGG - Intronic
1040513489 8:48116215-48116237 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1041902296 8:62995646-62995668 GGGAGTTTAGAGAGGTAGGAAGG + Intronic
1042137901 8:65649773-65649795 GGGTGGGGGGAGATGGAGTAGGG - Intronic
1045986187 8:108252092-108252114 GGTTGTTTAGGGCTGGAGTGAGG - Intronic
1048062948 8:130939067-130939089 GAGGGTTTAGAGATGTTGTAGGG + Intronic
1048177507 8:132165973-132165995 GAGTGCTTAGAAATGGAGAAAGG - Intronic
1048535810 8:135293095-135293117 GGGTGATTAGATATGGGGTGGGG - Intergenic
1048742807 8:137580699-137580721 GTGTGTTTAGAGAAAGATTACGG - Intergenic
1048995924 8:139793701-139793723 GGCTGTTTAGAGAGGTGGTACGG + Intronic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050579019 9:7031172-7031194 GTATGTTTTGAGATGGAGTCTGG + Intronic
1050592988 9:7179381-7179403 TGTTGTTTTGAGATGGAGTCTGG + Intergenic
1051176900 9:14370061-14370083 GGGTGTTTGGAGATGGCGAATGG - Intronic
1051253095 9:15181976-15181998 GGTTGCCTAGGGATGGAGTATGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055510420 9:76990809-76990831 AGGTGTGGAGAAATGGAGTAGGG - Intergenic
1056769397 9:89465950-89465972 GTGTGTCTAGAGATGGTGTCAGG + Intronic
1059084472 9:111285209-111285231 GGGGGTTAAGAGAGGGAGCAGGG - Intergenic
1059286292 9:113174674-113174696 GAGTTTTCAGAAATGGAGTAAGG - Intronic
1061509877 9:131053819-131053841 TGTTGTTTTGAGATGGAGTCTGG - Intronic
1062087194 9:134654941-134654963 GGGTGTGTAGAGCTGGGGGAGGG + Intronic
1185670241 X:1803726-1803748 GGGTGTCCAGAGATGGTGTCCGG - Intergenic
1187715113 X:22095085-22095107 GTGTGTTGAGGTATGGAGTAGGG + Intronic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1188145107 X:26602424-26602446 GGGTGTTGGGAGATGGAGATGGG - Intergenic
1188307112 X:28572128-28572150 GGGTGTTTGAAGAAGGGGTACGG - Intergenic
1189896556 X:45662968-45662990 GTGTGGTGAGAGATGGATTATGG - Intergenic
1190072211 X:47288720-47288742 GGGGGTTTAGTGTTGGAGTGGGG + Intergenic
1190299388 X:49047727-49047749 GGGTTTTTAGAGATAGAGTTCGG + Intergenic
1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1190872700 X:54437915-54437937 GTTTGTTTTGAGATGGAGTCTGG - Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192438244 X:71155698-71155720 GGGTGTTTAGAGATGTGGGGCGG - Intronic
1192538978 X:71952351-71952373 GAGTGTTTACAGTTGGAGAAGGG + Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1193181552 X:78464247-78464269 GGTTGTTTAGGGTTGGAGGAAGG - Intergenic
1193699410 X:84743571-84743593 GTGTGTATAGGGATGGTGTATGG - Intergenic
1194610272 X:96035065-96035087 GGGTCTTGAGGGGTGGAGTAGGG - Intergenic
1194638894 X:96378421-96378443 GTGTGTTTTGAGATGAAGCAGGG - Intergenic
1194684390 X:96895013-96895035 GTTTGTTTTGAGATGGAGTCTGG + Intronic