ID: 1029687706

View in Genome Browser
Species Human (GRCh38)
Location 7:102160140-102160162
Sequence CTGTCATCCAAGCTGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9604
Summary {0: 2, 1: 39, 2: 568, 3: 3405, 4: 5590}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029687706_1029687709 21 Left 1029687706 7:102160140-102160162 CCATACTCCAGCTTGGATGACAG 0: 2
1: 39
2: 568
3: 3405
4: 5590
Right 1029687709 7:102160184-102160206 AAAAAAAAGCAGTTACTGGAAGG No data
1029687706_1029687708 17 Left 1029687706 7:102160140-102160162 CCATACTCCAGCTTGGATGACAG 0: 2
1: 39
2: 568
3: 3405
4: 5590
Right 1029687708 7:102160180-102160202 AAAAAAAAAAAAGCAGTTACTGG 0: 2
1: 13
2: 263
3: 2354
4: 13164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029687706 Original CRISPR CTGTCATCCAAGCTGGAGTA TGG (reversed) Intronic
Too many off-targets to display for this crispr