ID: 1029687706 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:102160140-102160162 |
| Sequence | CTGTCATCCAAGCTGGAGTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9604 | |||
| Summary | {0: 2, 1: 39, 2: 568, 3: 3405, 4: 5590} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029687706_1029687709 | 21 | Left | 1029687706 | 7:102160140-102160162 | CCATACTCCAGCTTGGATGACAG | 0: 2 1: 39 2: 568 3: 3405 4: 5590 |
||
| Right | 1029687709 | 7:102160184-102160206 | AAAAAAAAGCAGTTACTGGAAGG | No data | ||||
| 1029687706_1029687708 | 17 | Left | 1029687706 | 7:102160140-102160162 | CCATACTCCAGCTTGGATGACAG | 0: 2 1: 39 2: 568 3: 3405 4: 5590 |
||
| Right | 1029687708 | 7:102160180-102160202 | AAAAAAAAAAAAGCAGTTACTGG | 0: 2 1: 13 2: 263 3: 2354 4: 13164 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029687706 | Original CRISPR | CTGTCATCCAAGCTGGAGTA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||