ID: 1029687958

View in Genome Browser
Species Human (GRCh38)
Location 7:102162001-102162023
Sequence CTCTAACATAAAAAGAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029687947_1029687958 24 Left 1029687947 7:102161954-102161976 CCTTGGAGTGCATTCAGAGATGA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1029687958 7:102162001-102162023 CTCTAACATAAAAAGAACTAGGG 0: 1
1: 0
2: 0
3: 12
4: 316
1029687956_1029687958 -7 Left 1029687956 7:102161985-102162007 CCAGGACAGGGAGGGGCTCTAAC 0: 1
1: 0
2: 2
3: 19
4: 158
Right 1029687958 7:102162001-102162023 CTCTAACATAAAAAGAACTAGGG 0: 1
1: 0
2: 0
3: 12
4: 316
1029687955_1029687958 -1 Left 1029687955 7:102161979-102162001 CCATGGCCAGGACAGGGAGGGGC 0: 1
1: 1
2: 8
3: 169
4: 1735
Right 1029687958 7:102162001-102162023 CTCTAACATAAAAAGAACTAGGG 0: 1
1: 0
2: 0
3: 12
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029687958 Original CRISPR CTCTAACATAAAAAGAACTA GGG Intronic
900674068 1:3872993-3873015 CTCTAAAAGAAAAAGAAAAAGGG - Intronic
900715898 1:4143521-4143543 CTCTTACATAAGAAGGAGTAGGG + Intergenic
902738797 1:18419838-18419860 CTGTAAAATAAAAAGAGCCAAGG - Intergenic
902950018 1:19875005-19875027 CTCTAAAATAAAATCAAATAAGG + Intergenic
904164720 1:28546751-28546773 CTCTACCAAAAAAAAAATTATGG + Intergenic
905041504 1:34963489-34963511 CTGTAACACAATAAAAACTAAGG + Intergenic
905216814 1:36414452-36414474 GTGTAACAAAATAAGAACTAGGG - Intergenic
906166012 1:43686719-43686741 CTCTAATATAAATCAAACTAAGG + Intronic
906802104 1:48746967-48746989 CTCTTAAATTAAAAGCACTAGGG - Intronic
906975422 1:50565710-50565732 TTGTAAAATAAAAGGAACTAAGG + Intronic
907256381 1:53182262-53182284 CAATTAAATAAAAAGAACTAAGG - Intergenic
908287682 1:62625614-62625636 TTCTAACATGCAAAGATCTATGG + Intronic
909069070 1:70971964-70971986 CTCTAGTCTAAAAAGAAATAAGG + Intronic
909750896 1:79159389-79159411 TTATCACATAAACAGAACTAAGG - Intergenic
909791469 1:79683746-79683768 TTCTAACAAATAAATAACTAAGG + Intergenic
910102893 1:83597709-83597731 CTCTAAAATGTAAAGAACTCTGG - Intergenic
910589520 1:88914835-88914857 ATATAACATAAACAGAATTATGG - Intergenic
910690203 1:89957970-89957992 CTAAAACATATAAAGAACTCTGG + Intergenic
911457468 1:98144524-98144546 CTCTAAAATAAAGAGAATAACGG - Intergenic
912941268 1:114047315-114047337 TTCTCACGTAAAAGGAACTAGGG - Intergenic
914398111 1:147290062-147290084 CTGTAAAATAAAAGGAACAAAGG + Intronic
916063190 1:161116226-161116248 CTCTAAAAAAAAAAGTACTGTGG + Intronic
916585966 1:166150303-166150325 CTCTTTGATAAAAAGAACTGAGG - Intronic
917141941 1:171843035-171843057 CACTAACAAAAAAAGAAAAAAGG - Intronic
917748154 1:178030590-178030612 CTCTAACATACAAATAACCTTGG + Intergenic
917850761 1:179062005-179062027 CTCAAAAAAAAAAGGAACTAGGG - Intronic
918756750 1:188347202-188347224 CTCTTAAATAGAAAGAAATATGG - Intergenic
918997936 1:191786460-191786482 TTCTGATAAAAAAAGAACTATGG + Intergenic
919055773 1:192568035-192568057 CTCTAACATCATAAGAAAAATGG + Intergenic
919188458 1:194184812-194184834 GTCAAACATATCAAGAACTATGG - Intergenic
919321907 1:196053219-196053241 CTATAACAAAAAAAGAAGAAAGG - Intergenic
919939406 1:202276098-202276120 CAACAACAAAAAAAGAACTATGG + Intronic
920099486 1:203508112-203508134 CTATAACAGAAAAAGAAAGATGG + Intronic
921239706 1:213166196-213166218 CTCAAATATAATAAAAACTATGG - Intronic
922356809 1:224784168-224784190 CTCTAACATAAACAGGAAGAGGG - Intergenic
922828928 1:228540865-228540887 CTCTAACATAAAAATGCCTGGGG + Intergenic
924018311 1:239752320-239752342 CTCTGACAGAAATAGAACAATGG - Intronic
924761199 1:246988610-246988632 TTCAAACATAAAGAGAAATAAGG + Intronic
1063065365 10:2602388-2602410 CTCTCACATAGAAAGAAAGAAGG - Intergenic
1063355003 10:5390030-5390052 CCCAAAGATAAATAGAACTAAGG + Intergenic
1063693549 10:8310445-8310467 CTCTCACATAAAAATAAGTCTGG - Intergenic
1065003239 10:21356383-21356405 CTCTAAAAAAAAAAGAAAAAGGG + Intergenic
1065678507 10:28204670-28204692 TGCTAACATAAAAAAAATTATGG + Intronic
1067094225 10:43287789-43287811 CTTGAATATAAAAAGTACTAAGG + Intergenic
1068424343 10:56839295-56839317 CTCTAAGACAAAATGAAGTAAGG - Intergenic
1068835684 10:61550299-61550321 CTCTAAGAAAAAATGGACTAAGG - Intergenic
1070045832 10:72835260-72835282 CACTACCATAAAAACAACAAAGG - Intronic
1070725671 10:78786847-78786869 CTCAAACAGAAAAAAAAATAGGG + Intergenic
1071360180 10:84838757-84838779 CTCTCCCATAAAAAGAAGTATGG - Intergenic
1072193906 10:93098469-93098491 CTCCACAATAAAAAGAAATACGG - Intergenic
1072599996 10:96916499-96916521 CTGTGATATAAAAGGAACTATGG + Intronic
1072836274 10:98717074-98717096 CCATAACATAAAAAGTACAAGGG - Intronic
1073395148 10:103211378-103211400 CTCCAACTTAAAAAGGACTGAGG + Intergenic
1073875502 10:107917195-107917217 TCCTGACATAAAAAGAAGTAAGG - Intergenic
1074358515 10:112806584-112806606 CTCAAAAATAAAAAAAAATAAGG - Intronic
1074997719 10:118772241-118772263 ATCTAACATAATAAGAAGCATGG - Intergenic
1075524683 10:123173789-123173811 CTCCAAAATAAATAGAACTCAGG + Intergenic
1075767523 10:124905644-124905666 CTCAAAAAAAAAAAGAACTTAGG - Intergenic
1076092286 10:127697521-127697543 TTATAAAATAAAAAGACCTATGG + Intergenic
1081332523 11:41822006-41822028 CTCCAAGATAATAAGTACTATGG - Intergenic
1082633196 11:55564426-55564448 CTCTAGAAAAAAAAGAACTAGGG + Intergenic
1082976565 11:59078389-59078411 ATCTTACAAAAAAAGAACAACGG + Intergenic
1085569675 11:77548321-77548343 CCCTGACATAACAACAACTATGG - Intronic
1086891597 11:92265084-92265106 CTCTAATATAAAAAGCTCCAGGG - Intergenic
1087799943 11:102492877-102492899 CTCTACTAAAAAAAGAACCAAGG + Intronic
1088216343 11:107514501-107514523 TTTTAAGATAAAAAGTACTAAGG + Intronic
1091084189 11:132704625-132704647 CTCTAAAATAAACAAAAGTAAGG + Intronic
1091276391 11:134355374-134355396 CACAAACATAAAAAGAAACAGGG - Intronic
1091475658 12:769631-769653 TTCTACAATAAAAAGAACCAGGG - Intronic
1092904104 12:13086613-13086635 CTCTAACCCTTAAAGAACTAAGG - Intronic
1094634673 12:32214255-32214277 GTCTACAGTAAAAAGAACTAGGG - Intronic
1095445040 12:42274324-42274346 CTCTAACAAAAAGAAAAATAGGG - Intronic
1096424341 12:51488598-51488620 CTCAAGAATAAAAAGAAATATGG + Intronic
1096439028 12:51623154-51623176 TTCTCCAATAAAAAGAACTAGGG - Intronic
1097788969 12:63793863-63793885 CCCTTACCTAAAAAGAACTTTGG + Intronic
1098547355 12:71726533-71726555 CTCAAAAAAAAAAAGAACAAAGG + Intergenic
1099061060 12:77909950-77909972 CTCAAACATGAAAACAACAAAGG - Intronic
1100002239 12:89851141-89851163 CTCTGGCAGAAAATGAACTAAGG - Intergenic
1100048402 12:90412450-90412472 CACTTACATACAAAGAACAATGG - Intergenic
1100494587 12:95112597-95112619 CTCAAACAAAAAAAGAACAAGGG + Intronic
1100652030 12:96601229-96601251 CTATCACATAAACAGAACCAAGG - Intronic
1102190597 12:110985032-110985054 CTCTAACTTCAGTAGAACTATGG + Intergenic
1102800493 12:115728641-115728663 ATTTAACATAAAAGGGACTAAGG + Intergenic
1103762522 12:123261912-123261934 CTCAGACATAAAGAGAACCAGGG + Intronic
1105686694 13:22790302-22790324 CTGGAAAATAAAAAGAACTGTGG - Intergenic
1106018236 13:25889563-25889585 ATCTAACAGGAAAAGAGCTAAGG - Intronic
1106105782 13:26732423-26732445 CTCTAAAATGCAAAGAACTCTGG - Intergenic
1106820111 13:33455361-33455383 CTCTAACACAAAAGGAAGTCAGG + Intergenic
1107438422 13:40402734-40402756 TTTTAACATGAAAAGAAATAAGG + Intergenic
1108428226 13:50326704-50326726 CTTTAGCTTAAAAAGAACCAGGG + Intronic
1111434467 13:88188670-88188692 CTCTCCAATAAAAAGAACTAGGG + Intergenic
1112643476 13:101303936-101303958 CTCTAACATGCAGAGAAATATGG + Intronic
1113041882 13:106113107-106113129 CTCTAAAATAAAACAAAATATGG - Intergenic
1114910695 14:27191983-27192005 TTCTAACATAAAAATCACCAAGG + Intergenic
1115260647 14:31449648-31449670 GTCTAATATAAATAGACCTAGGG + Intronic
1115476745 14:33822060-33822082 CTATATTAAAAAAAGAACTATGG + Intergenic
1115560621 14:34579604-34579626 CTCTAAAACAAAAAGAATAAAGG + Intronic
1118091874 14:62490229-62490251 TTATAAGATAAAAAGAATTATGG - Intergenic
1118628241 14:67678494-67678516 ATATGACATAAAAACAACTAGGG + Intronic
1119184093 14:72625532-72625554 TTCTCTCATAAAAAGAACCATGG - Intronic
1120537322 14:85713017-85713039 ATCTCACAAAAAAAGTACTATGG + Intergenic
1120813936 14:88833625-88833647 TTCTAAAATAAAAAGTCCTAAGG - Intronic
1123130569 14:105982339-105982361 CATTAACCTAAAAAGAACAATGG - Intergenic
1123140650 14:106074069-106074091 CTCTAACACAAGAAGAGCAAAGG - Intergenic
1123580809 15:21713560-21713582 CATTAACCTAAAAAGAACAATGG - Intergenic
1123617458 15:22156183-22156205 CATTAACCTAAAAAGAACAATGG - Intergenic
1124452350 15:29806904-29806926 CTCTAAAATAAAATGAAGAAGGG + Intronic
1126223722 15:46244888-46244910 TTCTAATTTAAAAAGAAGTAAGG - Intergenic
1126601277 15:50430344-50430366 CTCAAAAAAATAAAGAACTAGGG + Intronic
1127393453 15:58525384-58525406 CTCTGAACTAAAAAGGACTATGG - Intronic
1128164831 15:65454825-65454847 CTCTAATCTAAAAAAACCTACGG - Intronic
1128500653 15:68225135-68225157 CTTGAACAGAAAAAAAACTAAGG + Intronic
1130694279 15:86114580-86114602 CTCTAAAACAAAAAGAAGTTTGG + Intergenic
1202989679 15_KI270727v1_random:447805-447827 CATTAACCTAAAAAGAACAATGG - Intergenic
1132543816 16:523998-524020 CTCAAAAAAAAAAAGAACTGAGG + Intergenic
1136988090 16:35131024-35131046 CTCCAAACTAAAAAGAACAAAGG + Intergenic
1140174769 16:72646635-72646657 CTAAAACATAAAAAAAAATAAGG - Intergenic
1142069361 16:88082499-88082521 CTCTATCAAAAAAAGAAAAAAGG + Intronic
1143233713 17:5379806-5379828 CTGTAAAATAAAGGGAACTACGG - Intronic
1144268779 17:13597622-13597644 CTCTAAAATAAATAAAACAAAGG - Intronic
1144272759 17:13634314-13634336 CTCTAACATAAAGAGAAACAAGG - Intergenic
1144533728 17:16066252-16066274 CTGTAGCACAAAAAGAGCTACGG + Intronic
1145069006 17:19787285-19787307 CTCTAAAAAAATAAAAACTAAGG - Intronic
1146516389 17:33492978-33493000 CCCTGACATAAAAAGAACCAAGG - Intronic
1147480217 17:40754179-40754201 ATTTGACAGAAAAAGAACTAGGG + Intronic
1147961999 17:44173389-44173411 CTCAAAAAAAAAAAGACCTATGG + Intronic
1149146078 17:53494617-53494639 CTGCAAGATAAAAAGAGCTATGG - Intergenic
1149312905 17:55412887-55412909 CTTTAACATGAAAAGTAGTAAGG - Intronic
1151634114 17:75332431-75332453 ATTTAACAGAAAAAGAATTACGG + Intronic
1153135540 18:1913150-1913172 CTCTAAAATAAAACAAAATATGG - Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1155034707 18:22016300-22016322 CTCCAAAAAAAAAAGAACAAAGG - Intergenic
1155801685 18:30113366-30113388 CTCTAGCATAAAAAAATCAATGG + Intergenic
1156526943 18:37776611-37776633 CTCTAATGTAAAGAGAACTTAGG + Intergenic
1157073833 18:44442344-44442366 CTATAAAATAATAAGAAATAAGG + Intergenic
1157233171 18:45938493-45938515 GTCTAACTTAAATAGAACTTGGG - Intronic
1160349907 18:78168902-78168924 TTCTTACATCAAAAGCACTAGGG - Intergenic
1164384247 19:27759873-27759895 CTCTATCATTAAAATAACTGGGG + Intergenic
1164689611 19:30200798-30200820 CTCTATCTCAAAAAGAACTGTGG + Intergenic
927611423 2:24545163-24545185 CTCTCCAATAGAAAGAACTAAGG + Intronic
928037943 2:27843781-27843803 ATCAAACAGAAACAGAACTAAGG + Intronic
930956836 2:57212954-57212976 TACTAACATAACAAGAACTTTGG + Intergenic
931132143 2:59348663-59348685 CTCTAGCATAAAAACAAATGTGG + Intergenic
931181924 2:59910165-59910187 ATCTGACATGAAAAGACCTAAGG + Intergenic
931296828 2:60935557-60935579 ATCGAACATTTAAAGAACTACGG - Intergenic
933011003 2:77063260-77063282 TGCTACCATAAAAAGAACAAGGG - Intronic
934123622 2:88864947-88864969 CTGTAACATAAAATGAAACATGG + Intergenic
934892501 2:98083005-98083027 GTTTAACATTAAAAGAATTAGGG - Intergenic
936097944 2:109548175-109548197 CTCAAAAAAAAAAAAAACTAGGG + Intronic
936635398 2:114250508-114250530 GTCTCAGGTAAAAAGAACTAAGG + Intergenic
936672412 2:114672685-114672707 CTCTAACATAAAAATTATCATGG + Intronic
939042202 2:137203539-137203561 CTCTCACTAAAAAAGAAATATGG - Intronic
939625604 2:144473427-144473449 CTCTACCAAAAAAAGAATCAAGG - Intronic
940240464 2:151557737-151557759 CTATCACATAAACAGAACCAAGG + Intronic
940577708 2:155533188-155533210 CTCTAAGCTGAAAAGAACTAAGG + Intergenic
941187315 2:162333023-162333045 CTCTCACAAAAATAGAAATATGG + Intronic
941274680 2:163476241-163476263 ATCTAACATAAAATAAACAAAGG + Intergenic
942769732 2:179502459-179502481 CTCTAACATAAGAACAGCAAAGG - Intronic
943294284 2:186117180-186117202 ATATAACAGAAAAAGAACAAAGG - Intergenic
944071538 2:195675332-195675354 CTTTCACATAAAAAGAAGTCAGG - Intronic
944696511 2:202205749-202205771 ATTTAAGATAAAAAGAAATAAGG + Intergenic
945195753 2:207236218-207236240 TTCTTTCATAAAAAGAACTTGGG + Intergenic
946179033 2:217938975-217938997 CTCTAAGATGAAGAGAATTATGG - Intronic
946609936 2:221447288-221447310 CTCTTACAGAAAAAGAAACACGG + Intronic
949066199 2:241991865-241991887 ATCAAATGTAAAAAGAACTAAGG - Intergenic
1169481640 20:5987703-5987725 CTCTAATAAAAAAAGATCTCTGG - Intronic
1170465102 20:16615581-16615603 TTCTCACATAACAAGAAATATGG + Intergenic
1171120577 20:22565413-22565435 CTCCAATATAAAAACAACTTTGG - Intergenic
1172032973 20:31994703-31994725 CTCTAAAATAAAACAAAGTAAGG + Intronic
1172983947 20:38967600-38967622 CTCAAACAGAAAAACAACTCAGG - Intronic
1176880762 21:14190185-14190207 ATCTACCCTAGAAAGAACTAGGG + Intronic
1177012920 21:15750605-15750627 CTCAAAAAAAAAAAGAATTAGGG - Intronic
1178291382 21:31371606-31371628 TTCAACCTTAAAAAGAACTAAGG + Intronic
1178608529 21:34059537-34059559 CTGTAACATAATCAGACCTAAGG - Intergenic
1179468096 21:41591404-41591426 CTATAAATTAAAAAGAACTGAGG + Intergenic
1182103380 22:27672448-27672470 CTCAAAAAAAAAAAGAAATAGGG + Intergenic
1182223278 22:28775596-28775618 GTCTAATAGAAAAAGAAGTAAGG + Intronic
1182375935 22:29847843-29847865 CACATACATAAAAAGAAATATGG - Intergenic
1182631373 22:31688221-31688243 CTTTAACCTGAAAAGAAATAAGG + Exonic
1182995816 22:34811111-34811133 TTCTACCATAAAAGGAACCAGGG + Intergenic
1183872994 22:40754535-40754557 CTCTAAAAAAAAAAGAAAAAGGG + Intergenic
1185136421 22:49075919-49075941 CTTTGACATGAAAAGAATTAGGG - Intergenic
951211699 3:19982235-19982257 CTCCAAAATGAAAAGAAGTATGG + Intronic
951377611 3:21940080-21940102 CTCTAAAACAAAAAGACCCAGGG - Intronic
952124469 3:30284056-30284078 ATGGAACATAAAAAGAAATAAGG + Intergenic
952192617 3:31039873-31039895 ATTTAACATAAAATGAAGTAAGG + Intergenic
952882873 3:37996189-37996211 CTGAAACAAAAAAAGAACTTGGG + Intronic
954895820 3:53973874-53973896 CTCTAACATACAATAAACTCAGG - Intergenic
955363892 3:58295683-58295705 CTCTTATATAAAAAGAAAAAAGG + Intronic
956710699 3:72036294-72036316 CTTTAACAAAAAAGGAATTATGG + Intergenic
957512758 3:81210973-81210995 CTATAAGCTAAAAGGAACTAGGG + Intergenic
957853348 3:85840641-85840663 CACTAACACAAAATGAACAATGG - Intronic
959395236 3:105829009-105829031 CTGTAACTTAAAAAGAATTGTGG - Intronic
959495968 3:107052222-107052244 CTGTATCATAAATAGAATTATGG + Intergenic
959691007 3:109198234-109198256 CTCTAAAAGAAAAGGCACTAAGG + Intergenic
960100016 3:113731954-113731976 ATCTACCAGAAAAAAAACTAAGG - Intronic
960485861 3:118252092-118252114 TTCTCACATAAAAATAAGTATGG + Intergenic
960648138 3:119913113-119913135 CTCTAAAATACAAAGAAGCAAGG + Intronic
960857807 3:122120919-122120941 CCCAAACATAAAGAGAACTCTGG + Exonic
960957595 3:123045058-123045080 GTCAAACATTAAAAGAACTTGGG + Intergenic
962451246 3:135519130-135519152 CTCTTTCAGAAAAGGAACTAAGG + Intergenic
962911328 3:139853741-139853763 CTCACACATAAAAACACCTAGGG - Intergenic
963755199 3:149227872-149227894 CTCTATCATGAAAGGAACAAGGG - Intergenic
964517571 3:157529503-157529525 CTCACACATAGAAAGCACTATGG + Intronic
965280355 3:166743755-166743777 CTCTAACATATAAATGTCTAGGG - Intergenic
965438002 3:168676277-168676299 TTCTACTATAAAAAAAACTATGG - Intergenic
965488016 3:169302433-169302455 CTCTAAAATAAAAAGAAATCTGG + Intronic
966299087 3:178458939-178458961 CTCTAAGTTAAAAAGATCTCTGG + Intronic
966559270 3:181301350-181301372 CTTTAAAATAAAAGGAATTAAGG + Intergenic
968019462 3:195371653-195371675 CTCAAAAATAAAAAGAATTTTGG - Intronic
970246027 4:14064455-14064477 GTCTAAAAAAAAAAGAACAATGG + Intergenic
971056090 4:22914376-22914398 CACTAACTTAAAAAGAAATGAGG + Intergenic
972145175 4:36015101-36015123 CTCTTACATAACAAGAAATCTGG - Intronic
972922393 4:43960045-43960067 CTCTAACCTAAAATGAACAGGGG - Intergenic
973244604 4:47997284-47997306 CCCTAACATTAACAGAACTGGGG + Intronic
973659791 4:53092631-53092653 ATATGATATAAAAAGAACTATGG + Intronic
974005337 4:56550950-56550972 CTCTAACAGAAAAAAAAAAAAGG + Intronic
974320290 4:60338618-60338640 TTCTAACTTAAGAAAAACTAAGG - Intergenic
974337095 4:60563088-60563110 CACTAACATAACAAGATATATGG + Intergenic
975402308 4:73952286-73952308 TTTTAACATAAGAAGAAGTAGGG + Intergenic
975896075 4:79092605-79092627 CTCCCCAATAAAAAGAACTAGGG - Intergenic
977432823 4:96953570-96953592 GTCAAACATTAAAATAACTAGGG + Intergenic
977673831 4:99726171-99726193 CTCTCACACAAAAAGAATTCAGG + Intergenic
978292399 4:107157821-107157843 TTCTAGAATAAAAAAAACTAAGG + Intronic
978462287 4:108969498-108969520 TTCTCACATAAAAAGAAGTTTGG - Intronic
978602349 4:110442271-110442293 CCCTTACATCAAAAGAACTGAGG - Intronic
980272825 4:130608855-130608877 CCATAATATAAAATGAACTAGGG - Intergenic
980310378 4:131121414-131121436 ATTTAACATATAAAAAACTAAGG - Intergenic
982483366 4:155938005-155938027 CTGTAAGATAAAGAGAAGTAAGG - Intronic
983760881 4:171405061-171405083 ATCTCACATAAAAAGAAAAATGG - Intergenic
984378545 4:178962350-178962372 CTCTAACAAATAAAATACTATGG + Intergenic
988050772 5:26028679-26028701 CTAAAATATAAAAAGAAGTAAGG + Intergenic
988440933 5:31231854-31231876 CTCTAACATAAAGAGATAAAAGG + Intronic
989677580 5:43989948-43989970 CTCAAAAAAAAAAAGAAATATGG - Intergenic
990563881 5:57009781-57009803 CTCCAAAATAAAAATAACTAAGG + Intergenic
990807223 5:59678419-59678441 CTCTATCATTAAAAAAAATATGG + Intronic
991172364 5:63643418-63643440 CTCTAACTTCAAAAGGCCTAGGG + Intergenic
991407447 5:66314884-66314906 TTCTGACATAAAAATAACAAAGG + Intergenic
992196316 5:74342582-74342604 CTCTAAGAAAAAAAGAAGGAAGG - Intergenic
992847150 5:80762017-80762039 TTCTAAGATCAAAAGAAATAAGG - Intronic
993050863 5:82924196-82924218 CTCTAAGAAAAAAAGACCTTGGG + Intergenic
993566664 5:89484494-89484516 CTCTTAAATAAAAAGGACAAAGG + Intergenic
994064954 5:95528936-95528958 CTTTAAGATAAAAACAAATAGGG + Intronic
994955580 5:106527030-106527052 CTAGAAAATAAAAAGAAGTAAGG - Intergenic
996334638 5:122369546-122369568 ATTTAACAGAAAAAGAATTAAGG - Intronic
996401070 5:123063278-123063300 CTCTAACATGGAAAAAAATATGG + Intergenic
997281464 5:132650175-132650197 CTCTTCAATAAAAAGAACTCTGG + Intergenic
1005135165 6:22560123-22560145 CTATAAGATAGAAAGAAATAAGG + Intergenic
1005170944 6:22983956-22983978 CTGTTACATAAACAGAACCAAGG - Intergenic
1005600651 6:27423377-27423399 ATCTAACAAAAAAAGGACAAAGG - Intergenic
1006792179 6:36709891-36709913 CTCTTTCACAGAAAGAACTAAGG + Intronic
1008343181 6:50392156-50392178 ATCTAACATAAGAAAAACTAGGG + Intergenic
1008396354 6:51012132-51012154 CCCTACAATAAAAGGAACTAAGG - Intergenic
1012756963 6:103244106-103244128 TTCTCCAATAAAAAGAACTAGGG + Intergenic
1012837195 6:104284221-104284243 ATGTAATATAAAAAGAAATAGGG + Intergenic
1013497465 6:110712655-110712677 CTGAAACGTAAAAAGATCTAGGG + Intronic
1014148319 6:118023504-118023526 CTCAAATATATAAATAACTAAGG + Intronic
1014412896 6:121148614-121148636 ATCTAAAAAAAAAAGAAATAGGG - Intronic
1015220524 6:130799923-130799945 ATATAAGATGAAAAGAACTATGG - Intergenic
1016042420 6:139444830-139444852 CTCAAACAGAAAGAGATCTAGGG - Intergenic
1017546672 6:155458833-155458855 CTCAAAAAAAAAAAAAACTATGG + Intergenic
1018325295 6:162661257-162661279 GTCTAAAAAAAAAAGAACAAGGG + Intronic
1018875682 6:167820628-167820650 CTATAATATAGAAAGTACTAGGG - Intergenic
1020173630 7:5864936-5864958 CTCAAAAAAAAAAAGAACTAGGG + Intergenic
1021268101 7:18549937-18549959 CTACAAAAAAAAAAGAACTAGGG - Intronic
1021281486 7:18724866-18724888 CTCTAATATATAAAAGACTATGG + Intronic
1021723174 7:23524564-23524586 CTCTGAGATAAAAAGAAAGAAGG - Intronic
1022071892 7:26923954-26923976 TTCTAACATAACAAGAAGTCTGG - Intronic
1022120228 7:27301013-27301035 CTCTAACTGGAAAATAACTATGG - Intergenic
1022804206 7:33805695-33805717 CTGTTACCTAAAAAGAACTGAGG - Intergenic
1023367883 7:39483012-39483034 GTATCACATAAAAAGAACTGAGG + Intronic
1026022293 7:66718470-66718492 ATCCAATATATAAAGAACTAGGG - Intronic
1029687958 7:102162001-102162023 CTCTAACATAAAAAGAACTAGGG + Intronic
1030184143 7:106743757-106743779 CTTTAACAAAAAATGACCTATGG + Intergenic
1030732660 7:113008431-113008453 TTATCACATAAAAAGAAGTAGGG - Intergenic
1032222326 7:130003970-130003992 CTCAAAAATAAAAATAAATAAGG - Intergenic
1032435086 7:131894219-131894241 GTCTAACAGAAAAAGAACATAGG - Intergenic
1033096166 7:138433208-138433230 CTATAACACAAAAAAAACTTTGG - Intergenic
1036545412 8:9764182-9764204 CTCTAAATTAAAAATAATTATGG - Intronic
1037316420 8:17603725-17603747 CCCTAAGATTAAAAGATCTATGG - Intronic
1039006291 8:33041197-33041219 CTCTAAAATAAAAATACCTGTGG - Intergenic
1039157289 8:34575325-34575347 CTTAAACATAAATAAAACTATGG - Intergenic
1041473500 8:58237122-58237144 CTCCCACATAAAAAGATCAAAGG + Intergenic
1041606174 8:59784852-59784874 GTGTAATATAAAAAGAACTTTGG + Intergenic
1043249373 8:78051557-78051579 ATATCACATAAAGAGAACTAAGG - Intergenic
1043414288 8:80032211-80032233 CTCTACCAAAGACAGAACTAAGG - Intronic
1043536318 8:81208952-81208974 CTCAAACAGGAAAAGAAGTAGGG - Intergenic
1045002020 8:97886782-97886804 CTCTGACAAAGAAAGAACTATGG + Intronic
1046778327 8:118187995-118188017 CTCTACCCTAAAAAGAAGGAAGG + Intergenic
1046781556 8:118221014-118221036 TTCTAAAAAAAAAATAACTACGG + Intronic
1047378578 8:124331830-124331852 TTATAACAACAAAAGAACTAAGG + Intronic
1051271786 9:15362542-15362564 ATATAAAATAAAAAGAACTGGGG - Intergenic
1051784492 9:20727279-20727301 AACTAACTTAAAAAGAAATAGGG - Intronic
1052597852 9:30584407-30584429 TTATCACATAAACAGAACTAAGG + Intergenic
1054900817 9:70367754-70367776 CTCTAACCTCACAACAACTATGG - Intergenic
1055323446 9:75104242-75104264 CTCAAACAAAAAAAGCATTATGG + Intronic
1055354045 9:75418926-75418948 CTGATACATAAAAACAACTAAGG + Intergenic
1055789081 9:79902081-79902103 CTCTATCAAAACAAGAAATAAGG - Intergenic
1056022654 9:82456651-82456673 ATGTAACATAAAAAGAGCAAAGG + Intergenic
1056205350 9:84314640-84314662 CTGTAACAAAAAAGGAAGTATGG - Intronic
1056497621 9:87175689-87175711 ATCTTAAATAAAAAGATCTATGG - Intergenic
1056642699 9:88385033-88385055 CACTAACATCCTAAGAACTAGGG + Intergenic
1057176071 9:93000444-93000466 CTCTAAAATAAAAAAGATTAAGG - Intronic
1058363711 9:104182302-104182324 ATCTAACAAAAAAAGATTTATGG + Intergenic
1058435355 9:104957370-104957392 CTCTATCATAAAAGGAAAGAAGG + Intergenic
1060059070 9:120442977-120442999 ATCTAACATAAAAAGAATGTAGG + Intronic
1185657023 X:1693697-1693719 CTCTAAGAGAAAAAGAAAAAGGG - Intergenic
1185796385 X:2968634-2968656 CTCAAACATAAAAAGAAGACAGG + Intergenic
1186055723 X:5647624-5647646 ATCTAGGATAAAAAGATCTAGGG - Intergenic
1186285821 X:8043229-8043251 TTCTCACATAACAAGAACTCGGG + Intergenic
1186562320 X:10625865-10625887 AACCAACATAAAAAGAAGTAAGG + Intronic
1186799701 X:13080423-13080445 CTCAGCCATAAAAAGAAATAAGG + Intergenic
1187083892 X:16021705-16021727 CTGTAACATAAAGAGAATTTTGG + Intergenic
1187541213 X:20197148-20197170 CACTCACATAAAAAGTACAAAGG - Intronic
1187640638 X:21285201-21285223 CTCTCACATAACCAGAAGTATGG - Intergenic
1187720397 X:22144500-22144522 CTCAAGCATAAAAACAAGTAGGG - Intronic
1188081423 X:25846150-25846172 CTCCACCAAAAAAAGAAATATGG - Intergenic
1188905319 X:35784652-35784674 CTCAAACAGAAAAAAAACTCTGG - Intergenic
1188925324 X:36034795-36034817 TTCTACAATAAAAAGTACTAGGG - Intergenic
1189722015 X:43929794-43929816 CTCTACCAAATAAAGCACTAAGG + Intergenic
1189807632 X:44751536-44751558 CTGTAACATAAAACAAAGTAGGG - Intergenic
1191800133 X:65069721-65069743 TCATCACATAAAAAGAACTAAGG - Intergenic
1192291937 X:69806853-69806875 CTGGAACATAGAAAGAAATAGGG + Intronic
1195273170 X:103253153-103253175 CTCACACACAAAAAGAATTAAGG - Exonic
1197426979 X:126308892-126308914 CTCAAACATTAAAAAAATTATGG - Intergenic
1197457635 X:126697592-126697614 ATGGAATATAAAAAGAACTAAGG + Intergenic
1198130472 X:133689338-133689360 TTATATCATTAAAAGAACTATGG - Intronic
1198613108 X:138424049-138424071 CTCCATCACCAAAAGAACTATGG - Intergenic
1199970464 X:152856529-152856551 ATTTCCCATAAAAAGAACTAGGG + Intronic