ID: 1029690519

View in Genome Browser
Species Human (GRCh38)
Location 7:102178286-102178308
Sequence AGCTAACCACAGGGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029690513_1029690519 -1 Left 1029690513 7:102178264-102178286 CCAGTGAATGAATCGAGGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029690519 Original CRISPR AGCTAACCACAGGGGGAGGA AGG Intronic
901080503 1:6581165-6581187 AGTTTCCCACAGAGGGAGGAGGG - Exonic
901539968 1:9909679-9909701 ATCAAACTACAGAGGGAGGAAGG + Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
903225913 1:21894226-21894248 AGCCATGCCCAGGGGGAGGAGGG + Intronic
903986794 1:27234664-27234686 AGATAAACAGAGGAGGAGGAGGG + Exonic
906528994 1:46512533-46512555 GGATAACCACAGGGCTAGGAGGG - Exonic
906777833 1:48545684-48545706 AGCCAGCCACATGGGGAAGATGG + Intronic
910116745 1:83739735-83739757 AGCTATAGACATGGGGAGGAGGG - Intergenic
911035037 1:93533512-93533534 ACCTATCCTCAAGGGGAGGAGGG - Intronic
911747924 1:101461155-101461177 AGGTTACCCCAAGGGGAGGAAGG + Intergenic
913232442 1:116751805-116751827 AGCTGGCCAGAGGGGAAGGAGGG - Intergenic
915754964 1:158250557-158250579 AGCTAACCAGAGTTGTAGGATGG - Intergenic
916675961 1:167064756-167064778 TGCAAAGCACAGGAGGAGGATGG - Intronic
918441459 1:184571544-184571566 AGCAAACAACAGGGGGTAGAGGG - Intronic
920066321 1:203272480-203272502 GGCTGAGCACAGGGGAAGGATGG + Intronic
920086909 1:203424046-203424068 AACTGAGCACAGAGGGAGGAAGG + Intergenic
920100549 1:203514497-203514519 ATTTAGCCACAGGGGGAGAAAGG - Intergenic
920844330 1:209581115-209581137 AGCCAGGCACAGGAGGAGGATGG + Intergenic
920987880 1:210907610-210907632 GGCTGAGCACAGGTGGAGGAGGG + Intronic
924544270 1:245010530-245010552 AGCTTCCCACAGGGGGACCAGGG - Intronic
1063048205 10:2415879-2415901 AGCTATCCACAGGTGCATGAGGG + Intergenic
1064706914 10:18082524-18082546 AGATAACAAGAGTGGGAGGAAGG - Intergenic
1067077965 10:43198818-43198840 TGCTAGCCCCAGGGAGAGGAGGG + Intronic
1067358003 10:45549096-45549118 AGATAACGAAAGGGGGATGAAGG + Intronic
1074892777 10:117749241-117749263 TGCTAACCACTGGGGAAGCAGGG - Intergenic
1076290062 10:129339301-129339323 ACCCAAACCCAGGGGGAGGAAGG + Intergenic
1077556840 11:3230122-3230144 AGGTAACCACAGGGGCAGCATGG - Intronic
1080606851 11:33870588-33870610 AGCTAATCCCAGAGGGAGGGTGG + Intronic
1081362476 11:42197468-42197490 AGCTTACTTGAGGGGGAGGATGG + Intergenic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1081529415 11:43947774-43947796 AGAGACCCACAGGGGTAGGAAGG + Intergenic
1083476467 11:62918802-62918824 AGAGAACCACTGGGGGAGGCAGG + Intronic
1084096558 11:66915291-66915313 AGATAACCACAGTGGGAGGGAGG + Intronic
1084193563 11:67510123-67510145 AAATAACCACAGGGTCAGGAAGG + Intergenic
1084596757 11:70121118-70121140 AGCTCTGCACCGGGGGAGGAGGG - Intronic
1084893214 11:72247186-72247208 AGCCAAGAACAGGGGGAGGCAGG - Intergenic
1085759594 11:79230506-79230528 AGCTAGCCACAGGCAGAGGCTGG - Intronic
1087599708 11:100297798-100297820 GGCTAAAAACAGTGGGAGGAAGG + Intronic
1090226152 11:125073336-125073358 AGCTATGCACAGCGGGAGGCGGG + Intronic
1091772629 12:3162949-3162971 TGCTGTCCACAGTGGGAGGAAGG - Intronic
1093219125 12:16398262-16398284 AGAGAACCAAAAGGGGAGGATGG + Intronic
1097214030 12:57395810-57395832 GTCTAACCTCTGGGGGAGGAGGG + Exonic
1097957005 12:65496510-65496532 ACCAAACAACAGGAGGAGGAAGG + Intergenic
1101614418 12:106322227-106322249 AGCCAAGCACAGGAGGAGGCTGG - Intronic
1101780361 12:107829520-107829542 GGCTAACAACAGAGGAAGGAAGG - Intergenic
1102668835 12:114600101-114600123 AGCTACACACTGGGGGAAGAGGG + Intergenic
1104791760 12:131487201-131487223 ATCTGAATACAGGGGGAGGAGGG - Intergenic
1107323226 13:39211485-39211507 AGCTAACCACAGAAGGTGCAGGG - Intergenic
1107979529 13:45721247-45721269 AGCTGACCACAGGTGCATGAGGG - Intergenic
1108205832 13:48089208-48089230 AGCTAACCTTAGGGGTAGTAAGG - Intronic
1110593361 13:77290695-77290717 AGCTAAGGAGAGGGTGAGGAAGG + Intronic
1111333662 13:86792790-86792812 AGCTAGACACAGGGTGATGATGG - Intergenic
1111902224 13:94213543-94213565 AGCTACCCACAGGGGCATGAGGG - Intronic
1112118577 13:96384541-96384563 ACCTAACACCAGGGCGAGGAAGG - Intronic
1113360777 13:109629380-109629402 ACGTAATCACAGGGGGAGAAAGG + Intergenic
1113896954 13:113770659-113770681 AGCCAACAACAGGGGGTGGGTGG - Intronic
1114298424 14:21351658-21351680 AGAGAACCAGAAGGGGAGGATGG + Exonic
1116681344 14:47973775-47973797 ATCTCACCACAGGAGGAGTAGGG - Intergenic
1118370841 14:65136000-65136022 ATCTAGCAACAGGGGGAGGGAGG - Intergenic
1120155209 14:81085802-81085824 AGCTTTCCATTGGGGGAGGAGGG - Intronic
1120206056 14:81588897-81588919 TGCTAAGCATAGGGGGAAGATGG + Intergenic
1121968742 14:98336372-98336394 AGCCAAGCTCAGAGGGAGGAAGG + Intergenic
1122667351 14:103340560-103340582 AGGTAAACATTGGGGGAGGAGGG + Exonic
1123101901 14:105809184-105809206 AGCAAACCACACCGGGAAGATGG + Intergenic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1126705185 15:51399420-51399442 AGCAAACCTGAGGGAGAGGAGGG - Intronic
1129644974 15:77420981-77421003 TGCTGACGACAGGGGCAGGAAGG - Exonic
1131476434 15:92744139-92744161 AGCTAGCCACATGGAGAGAATGG - Intronic
1131989575 15:98080304-98080326 AGCTAACAACAGTGGGAGGTGGG - Intergenic
1132229358 15:100170192-100170214 AGGTAACTAAAAGGGGAGGACGG - Intronic
1132304858 15:100803687-100803709 GGCTAACCACATGTGCAGGAGGG + Intergenic
1132519256 16:379864-379886 AGGTGACCACAGGGTGAGGAGGG + Intronic
1137949646 16:52771493-52771515 TGCCAGCCACAGGAGGAGGAGGG + Intergenic
1138115747 16:54359081-54359103 AACTACCCACACGGGAAGGAAGG - Intergenic
1138631669 16:58300039-58300061 TGCTAACCTCTGGGAGAGGAGGG - Intronic
1139215218 16:65120937-65120959 AGCTGGCCAGATGGGGAGGACGG - Intronic
1139216003 16:65124028-65124050 AGGGACCCACAGGGGGAGGCAGG - Intronic
1141476050 16:84274248-84274270 AGCTAACCACAGTAGCAAGATGG + Intergenic
1141648409 16:85379518-85379540 TGCTCACCACGGGGTGAGGAAGG - Intergenic
1142729171 17:1839745-1839767 AGCTACTCAGAGGGTGAGGAGGG - Intronic
1143891446 17:10105593-10105615 AGCTGGCCACAGGGAGGGGAAGG - Intronic
1148556192 17:48580219-48580241 AGCTAAGCACAAAAGGAGGAAGG + Intronic
1149254214 17:54806690-54806712 AGGAAACAACAGGGGTAGGAGGG - Intergenic
1149693578 17:58598732-58598754 AGGTAACCTGAGTGGGAGGAAGG - Intronic
1151126897 17:71855125-71855147 GGCTGACCAGAGAGGGAGGAAGG - Intergenic
1151403082 17:73868879-73868901 AACCAACCACAGGGAGAGGAAGG + Intergenic
1151480735 17:74368904-74368926 GGCTACCCCCAGGGGCAGGATGG - Intronic
1151668842 17:75560386-75560408 AGCTAACTACAGGGTGAGGCTGG - Intronic
1153186121 18:2488419-2488441 AGAACAACACAGGGGGAGGAAGG - Intergenic
1153749789 18:8217361-8217383 AGCTGGGCACAGGGGGAAGAAGG - Intronic
1154268919 18:12902359-12902381 AGTGAACCACAAGGGGAGGGTGG + Intronic
1155240125 18:23856857-23856879 AGGTATCCAGATGGGGAGGAGGG - Intronic
1156492319 18:37503495-37503517 AGCTAAGCACAGGATGTGGAAGG - Intronic
1161076618 19:2288902-2288924 AGCTGACCACAGAGGCAGGCAGG - Intronic
1161252130 19:3285906-3285928 AGCGAGACACAGGGCGAGGAGGG - Intronic
1162473166 19:10884552-10884574 AGGCAAGCACAGGGGGAGGGGGG - Intronic
1162897801 19:13775868-13775890 AAGTGATCACAGGGGGAGGAGGG - Intronic
1165721504 19:38082487-38082509 AGCAAACCCGAGGGGGAGGCTGG + Exonic
925228448 2:2207440-2207462 AGCTCAACACAGGGTGAGGCTGG - Intronic
926329115 2:11810359-11810381 AGCTCACCACAGGTGGAAGTAGG + Intronic
927480361 2:23448960-23448982 AGCAAGGCACATGGGGAGGAAGG + Intronic
930409306 2:51003745-51003767 AGCAAAGGAGAGGGGGAGGAAGG + Intronic
934159337 2:89233669-89233691 AGCTGTCCTCAGGGGGAGTATGG - Intergenic
935379436 2:102436186-102436208 ACCTAAGCCAAGGGGGAGGATGG - Intronic
936043964 2:109171937-109171959 AGCTCACCACAGCGAAAGGAGGG - Intronic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
938387417 2:130876779-130876801 AGCTAACTAGAGGGGAAGGTGGG + Intronic
938691882 2:133799540-133799562 AGGCAACCCCAAGGGGAGGAAGG - Intergenic
941354186 2:164468475-164468497 AGAAAACCGCAGTGGGAGGAAGG - Intergenic
942068925 2:172297839-172297861 AGGTAAGCAGAGGGGGAGGAGGG - Intergenic
942199736 2:173559138-173559160 AATTTACCACAGGGGGAGGATGG - Intergenic
942260643 2:174158247-174158269 AGCTGACCACAGGGGAATAAGGG - Intronic
942265307 2:174218751-174218773 AGCAAACCCCAGGGGTGGGAGGG + Intronic
942463538 2:176186385-176186407 ATCTAGCCAGAGGTGGAGGAGGG + Intergenic
945754352 2:213828905-213828927 AGCTGTCCACAGCTGGAGGATGG + Intronic
947853889 2:233310156-233310178 AGCTATCCACAGAGGCTGGACGG - Intronic
948823778 2:240564496-240564518 AGCTGACCAGAGGGAGAGGACGG - Intronic
948924238 2:241083642-241083664 AACTAAGCACAGCGGGAAGATGG - Intronic
1168751975 20:289105-289127 TGCTAACCACAAGGGAAGGTGGG - Intronic
1170171223 20:13415233-13415255 AGGAAACCAGAGGGAGAGGAAGG + Intronic
1171989439 20:31684496-31684518 AGCTGAGCCCAGGGGAAGGATGG + Intronic
1172090499 20:32428482-32428504 AGCTCACTACAGGAGAAGGAGGG - Intronic
1172260734 20:33562534-33562556 AGCTAATGAAAGGAGGAGGAAGG + Exonic
1172345264 20:34193202-34193224 AGCTCCTCACAGGGGGAGGTGGG - Intergenic
1172944519 20:38676886-38676908 AGCTGACCACAGCAGGAGGCTGG + Intergenic
1173759275 20:45545587-45545609 AGGTGAGGACAGGGGGAGGAGGG + Intronic
1176111008 20:63410729-63410751 ACCCCACCACAGAGGGAGGAGGG + Intronic
1176120812 20:63453743-63453765 AGTTGGCCACAGGGGGAGAAGGG + Intronic
1177009582 21:15715798-15715820 AGATAAGCACATGGTGAGGAAGG + Intergenic
1177051622 21:16241968-16241990 ATCTCACCACAGAGGGAGGTGGG - Intergenic
1179828487 21:43981668-43981690 AGCTCACCACAGGGACAGGCTGG - Intronic
1181438428 22:22923436-22923458 AGCTGGGCACAGAGGGAGGAGGG - Intergenic
1182227693 22:28812250-28812272 ACCTCACCAAAGGGGGAGGGAGG - Intergenic
1183227031 22:36557481-36557503 ATGCCACCACAGGGGGAGGAGGG - Intergenic
949507281 3:4739645-4739667 AGATAACTACAGGTGGAGGTGGG - Intronic
950526253 3:13526024-13526046 GGCCAGCCACACGGGGAGGAGGG + Intergenic
952530364 3:34256575-34256597 AGAAAACCACTGAGGGAGGAAGG + Intergenic
954155853 3:48684659-48684681 TTCTGACCACAGGGGGAAGAAGG - Intronic
954419272 3:50410064-50410086 GGCTAACCACAGGTAGAAGAGGG - Intronic
954458386 3:50612112-50612134 AGCTACCCAGAGGGGCAGGTCGG + Exonic
958790629 3:98646866-98646888 AGAAAACCACAGGAGCAGGATGG + Intergenic
961971993 3:130977791-130977813 CGGTAATCTCAGGGGGAGGATGG - Intronic
963367884 3:144362305-144362327 AGCTAAACACAGAGGCAAGAAGG + Intergenic
964285612 3:155114644-155114666 TGCTAACCTCAGGTGCAGGATGG + Intronic
964364450 3:155934440-155934462 AGATACCCACAGGGGAATGAGGG - Intronic
964556150 3:157941061-157941083 ACCTCAGCACAGTGGGAGGAAGG - Intergenic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
968360084 3:198140517-198140539 AACCAGCCACAGGGGAAGGAGGG - Intergenic
969537088 4:7762945-7762967 TGCTAGCCCAAGGGGGAGGAGGG + Exonic
970441275 4:16083091-16083113 AGCCGACCACAGCGGGAGTAGGG - Intronic
970618812 4:17796055-17796077 AACTGAGGACAGGGGGAGGATGG - Intergenic
975374189 4:73623795-73623817 CGCTAGCCACAGGTGGAGAATGG - Intergenic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
992061270 5:73050266-73050288 AGCTAAACAGAGAGGGAGGGAGG - Intronic
992369753 5:76130773-76130795 AGCTAACCAGAGTGGCAGGTGGG + Intronic
993803508 5:92374978-92375000 AGCCCACCGCAGGGGGATGAGGG + Intergenic
994022747 5:95046704-95046726 AACTAACTGCAGGGAGAGGAAGG - Intronic
995252909 5:110014882-110014904 GGCTAGCCACATGGGGAAGAAGG + Intergenic
996399997 5:123052082-123052104 ACCTAACCACAAGGGAAGAAAGG - Intergenic
998688733 5:144561471-144561493 AGCTAACCACAGTTGGTGGTGGG + Intergenic
1003089505 6:3090156-3090178 TGCTAAGTACAGGGGAAGGAGGG - Intronic
1003117682 6:3294058-3294080 GGCTAGCCCCAGGGGAAGGACGG - Intronic
1005813058 6:29530859-29530881 AGAAAACCACAGCTGGAGGAAGG - Intergenic
1006098988 6:31674014-31674036 AGCTAAGCAGAGGGTGGGGAGGG - Intergenic
1006116167 6:31777188-31777210 GGCTCAGCAGAGGGGGAGGAAGG + Exonic
1007172673 6:39875211-39875233 AGCTTACCATAGGTGGAGAAGGG + Intronic
1007389418 6:41541877-41541899 AGAAAACCACAAGGGAAGGATGG + Intergenic
1007966486 6:46008184-46008206 AGCCAACAACAGTGGCAGGAGGG - Intronic
1008050862 6:46899190-46899212 AGATAAACAAAGGGGGATGATGG + Intronic
1009033850 6:58093040-58093062 GGCTAACAACAGTGGAAGGAAGG - Intergenic
1009209459 6:60844747-60844769 GGCTAACAACAGTGGAAGGAAGG - Intergenic
1014500337 6:122180896-122180918 AGCTAACCACAGGGGCTTGCTGG - Intergenic
1016943918 6:149510290-149510312 AGTTACCCACAGAGGGAAGAAGG + Intronic
1018012428 6:159683669-159683691 TGCTTTCCACAGGGAGAGGAAGG + Intronic
1019259909 7:76102-76124 AACCAGCCACAGGGGAAGGAGGG + Intergenic
1020057732 7:5129823-5129845 AGCTGTGCACAGGGGCAGGAAGG - Intergenic
1020169790 7:5836180-5836202 AGCTGTGCACAGGGGCAGGAAGG + Intergenic
1022430389 7:30313805-30313827 ACATCACCACTGGGGGAGGAAGG - Intronic
1022987423 7:35671104-35671126 AGATAACCAAATGGGGAGAAAGG + Intronic
1029514986 7:101018484-101018506 AGGGAACCCCAGGGGGAGGGAGG - Intronic
1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG + Intronic
1032134043 7:129258119-129258141 AGGTAACCACAATGGGAGAATGG - Intronic
1033709339 7:143924805-143924827 AGCTTTCCACAGGGAGAAGAAGG + Intergenic
1034937002 7:155206715-155206737 AGCTCATCACAGGGGGAAGCAGG + Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035607277 8:938307-938329 AGCTACCCAGAGACGGAGGAAGG - Intergenic
1036002484 8:4623555-4623577 AGCTAAAAACAGGGGGGTGAGGG + Intronic
1036401151 8:8409639-8409661 AGCTAACCAAAAAGGGGGGAGGG - Intergenic
1037251899 8:16905266-16905288 AGCTAATCACAGGTGGATTAAGG - Intergenic
1038494180 8:27990073-27990095 AGCTGACCAGAAGAGGAGGAAGG - Intronic
1038512236 8:28149554-28149576 AGCTAACAAAAAGGAGAGGATGG - Intronic
1038822625 8:30966634-30966656 AGCTAACTACAAAGGGAGGTTGG + Intergenic
1038946129 8:32362041-32362063 AGCTAACCAAATCTGGAGGAGGG - Intronic
1039017721 8:33170927-33170949 TCCTAACCCCATGGGGAGGATGG + Intergenic
1040373110 8:46796359-46796381 AGCTTACCACATAGTGAGGAAGG + Intergenic
1040603778 8:48910078-48910100 GGACAAGCACAGGGGGAGGAGGG + Intergenic
1041058257 8:54010073-54010095 AGCTAGCTTCAGGGTGAGGATGG - Intronic
1041360802 8:57051890-57051912 AGCAAACAAGAGGGGAAGGAAGG + Intergenic
1043863722 8:85352164-85352186 ACCTAACCTCAAGGGGTGGATGG + Intronic
1047782741 8:128123231-128123253 ACCTCTCCATAGGGGGAGGAAGG - Intergenic
1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG + Intergenic
1049460886 8:142727208-142727230 AGCGAACCACAGCGCGAGGGCGG - Exonic
1053363820 9:37508763-37508785 AGCAGACCCCAGGGGGATGAGGG + Intergenic
1056348677 9:85725463-85725485 TGCTACGCATAGGGGGAGGATGG + Intronic
1057488146 9:95502180-95502202 AGCTAGGCACAGGGGCTGGAGGG - Intronic
1062024928 9:134335888-134335910 AGCTGCCCACAGGGAGAGGCAGG - Intronic
1062744790 9:138204357-138204379 AACCAGCCACAGGGGAAGGAGGG - Intergenic
1187127672 X:16469301-16469323 ACCCAAGCAGAGGGGGAGGAGGG + Intergenic
1188664994 X:32808158-32808180 AGCTAAAAACAGGGGTAGGAGGG + Intronic
1189074767 X:37904535-37904557 AGCCAGAGACAGGGGGAGGAAGG + Intronic
1189744748 X:44158042-44158064 AGCCAACCACAGGCTGAGTAGGG - Intronic
1190340795 X:49293880-49293902 AGCTACTCAGAGGCGGAGGAGGG + Intronic
1196402823 X:115333896-115333918 ATCTCATCCCAGGGGGAGGAGGG - Intergenic