ID: 1029690983

View in Genome Browser
Species Human (GRCh38)
Location 7:102181285-102181307
Sequence AACTGAATCCTGGTACTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029690983 Original CRISPR AACTGAATCCTGGTACTCAT TGG (reversed) Intronic
901722121 1:11207482-11207504 CACTGCACCCTGGAACTCATGGG + Intronic
901960823 1:12825299-12825321 ATCTAAATCCAGGTACTCAAGGG + Exonic
901967419 1:12879901-12879923 ATCTAAATCCAGGTACTCAAGGG + Exonic
901975217 1:12939032-12939054 ATCTAAATCCAGGTACTCAAGGG + Exonic
901986202 1:13077173-13077195 ATCTAAATCCAGGTACTCAAGGG - Exonic
901995610 1:13149594-13149616 ATCTAAATCCAGGTACTCAAGGG + Intergenic
902009958 1:13262732-13262754 ATCTAAATCCAGGTACTCAAGGG - Exonic
902017754 1:13321885-13321907 ATCTAAATCCAGGTACTCAAGGG - Exonic
906389043 1:45397981-45398003 AACTGCAGCCTTGAACTCATGGG + Intronic
906435743 1:45795072-45795094 CACTGTATCCTGGAACTCCTGGG - Intronic
907445715 1:54506556-54506578 AGCTGAATTCTGCTACTCCTTGG - Intergenic
911441723 1:97935098-97935120 CACTGAAGCCTGGAACTCCTGGG - Intergenic
917983866 1:180294768-180294790 CACTGCATCCTGGAACTCCTGGG + Intronic
918831887 1:189408891-189408913 TACTGTAGCCTGGTACTCCTGGG + Intergenic
918995581 1:191754611-191754633 AACTCAATTCTGGAACTCCTCGG - Intergenic
921123036 1:212153196-212153218 AACTGCAGCCTGGAACTCCTGGG - Intergenic
921382173 1:214535109-214535131 AATTAATTTCTGGTACTCATTGG - Intronic
921644421 1:217597255-217597277 AACTGCAGCCTGGAACTCCTGGG - Intronic
921812359 1:219529395-219529417 AACTGCATCCTGACATTCATGGG - Intergenic
922818355 1:228467318-228467340 AAATCAGTCCTGGTTCTCATGGG + Intergenic
1062837806 10:647646-647668 AACTGAATCCACGTCCACATTGG + Intronic
1064522082 10:16213034-16213056 AAGTAAATCTGGGTACTCATGGG - Intergenic
1064829817 10:19450344-19450366 AGCAGAACCCTGGTAATCATTGG + Exonic
1064842226 10:19606477-19606499 TGCTGAACCCTGGTACTCAGAGG + Intronic
1064970973 10:21066838-21066860 AACTGAATATTTATACTCATGGG + Intronic
1065485092 10:26229510-26229532 AACTGAATCCTCAGACTCAAAGG - Intronic
1066545702 10:36498095-36498117 CACTGACTCCTGATGCTCATTGG + Intergenic
1068532788 10:58208562-58208584 AACTGATTCTTGGTACTTGTAGG + Intronic
1070415070 10:76181599-76181621 TCCTGAATCCCGGTACTTATGGG - Intronic
1078463805 11:11535518-11535540 GGCTGACTCCTGGTTCTCATGGG + Intronic
1078946009 11:16069793-16069815 AAATGGGTCCTGGTTCTCATGGG - Intronic
1080539649 11:33254237-33254259 CACTGCAGCCTGGAACTCATGGG + Intergenic
1082783841 11:57305773-57305795 AACTTACTCCCAGTACTCATGGG - Intronic
1083942769 11:65906491-65906513 AACTGCAACCTTGTACTCCTGGG + Intergenic
1086263222 11:84966385-84966407 AACAGAACCCTAGAACTCATAGG + Intronic
1091570401 12:1680346-1680368 GACTGAAGCCTGGAACTCCTGGG + Intergenic
1095614810 12:44175652-44175674 AACTAAATGGTGGTATTCATTGG - Intronic
1100116731 12:91314669-91314691 AACTGAAGCCTTGTACCCTTTGG + Intergenic
1101399655 12:104376455-104376477 CACTGAATCCTTGCACTCCTAGG - Intergenic
1102327655 12:112001986-112002008 AACTGAATCCTGGTAAGGTTAGG - Intronic
1104133338 12:125915533-125915555 ACGTGCCTCCTGGTACTCATAGG + Intergenic
1105579557 13:21682082-21682104 CACTGCAGCCTGGAACTCATGGG + Intronic
1105911531 13:24872509-24872531 AACTCAAGCCTAGCACTCATTGG + Intronic
1106751496 13:32774292-32774314 ATATGAATCCTGGTACAGATAGG - Intronic
1107538215 13:41357243-41357265 AACTGTAGCCTGGAACTCCTAGG - Intronic
1107576127 13:41724697-41724719 AACTGAATCCTGGTTAGCAATGG + Intronic
1108360762 13:49666237-49666259 AACTGAAGCCTGCTACTGAGGGG + Intronic
1108492728 13:50997608-50997630 AACAAAATGATGGTACTCATAGG - Intergenic
1109809399 13:67491627-67491649 AACAGAGTCTTGGTACTTATGGG + Intergenic
1112345789 13:98588100-98588122 AACTGTATCCTGGAACTCCTGGG - Intergenic
1117677114 14:58166351-58166373 CACTGCATCCTGGAACTCCTGGG - Intronic
1119488588 14:75009929-75009951 CACTGAAGCCTTGAACTCATGGG - Exonic
1120040036 14:79742327-79742349 AAATGAATCGAGGTAATCATAGG - Intronic
1120457115 14:84745913-84745935 CACTGAAACCTGGAACTCCTGGG - Intergenic
1121810003 14:96876959-96876981 ACATGAATCCTGGAACACATTGG - Intronic
1122312203 14:100804398-100804420 AACGGCTTCCTGGTCCTCATCGG + Intergenic
1122655137 14:103253651-103253673 AACTGCAGCCTGGAACTCCTGGG + Intergenic
1124886375 15:33690378-33690400 AATTGAATCCTGGCAGTCAAGGG - Intronic
1125445183 15:39746636-39746658 AACAGCATCCTGGTAATCAATGG + Intronic
1125476136 15:40049249-40049271 ATCTGAATTCTGCCACTCATTGG + Intergenic
1127644139 15:60943548-60943570 AACTGAATGCGGGTCCACATTGG - Intronic
1129521472 15:76189114-76189136 CACTGCAGCCTTGTACTCATGGG - Intronic
1130414523 15:83679889-83679911 ACCTTAATCCTGGTAATAATGGG - Intronic
1134874250 16:17682523-17682545 AACTGAATCCAGGCACTGGTTGG - Intergenic
1136543369 16:30941650-30941672 GACTGAGTTCTGGTGCTCATGGG - Intronic
1137653825 16:50142841-50142863 CACTGCATCCTGGAACTCCTGGG - Intergenic
1138273345 16:55712049-55712071 AACAGAATCATGGTTCTCTTAGG + Intergenic
1144342413 17:14320825-14320847 AACTGAATGCTGGAACTGAGCGG - Intronic
1149972612 17:61234235-61234257 AGCTGTATCCTAGTACTCAGTGG - Intronic
1152140311 17:78532635-78532657 AAAGGAATCCTGGTACTCCTCGG + Exonic
1154100587 18:11469298-11469320 CACTGAAGCCTGGAACTCCTGGG - Intergenic
1155193228 18:23449703-23449725 CACTGCAACCTGGAACTCATGGG - Intergenic
1162133266 19:8540252-8540274 AACTGCAGCCTGGAACTCCTGGG + Intronic
1162272997 19:9631469-9631491 AACTGCATCAAGGGACTCATTGG + Intronic
1162939589 19:14000720-14000742 CACTGAAGCCTGGAACTCCTGGG - Intronic
1163198136 19:15740184-15740206 CACTGCATCCTGGAACTCCTGGG - Intergenic
1165254785 19:34569503-34569525 CACTGCATCCTGGAACTCCTGGG + Intergenic
1167903010 19:52636237-52636259 AACTGCAGCCTGGTCCTCCTGGG - Exonic
927198992 2:20566967-20566989 AACTCAATCCTTGTTCTCAGGGG - Intronic
933403070 2:81823043-81823065 CACTGAATCCTCAAACTCATGGG + Intergenic
936592100 2:113813917-113813939 CACTAAATCCTGGAACTCCTGGG + Intergenic
940072558 2:149705283-149705305 AACTGTAACTTTGTACTCATTGG + Intergenic
945190786 2:207185366-207185388 AACTCCATCCTGGAGCTCATGGG - Intergenic
946502231 2:220261742-220261764 AACTCAATCCTGTTCCTGATTGG + Intergenic
947553172 2:231062844-231062866 AACTGAGTGCTGGTTCTCAGTGG + Intronic
948532413 2:238618244-238618266 AACAATAGCCTGGTACTCATGGG - Intergenic
1169302914 20:4460568-4460590 AAATGAATCCAGATACACATGGG - Intergenic
1169376030 20:5067206-5067228 CACTGATTCCTGGCACTCATTGG + Intergenic
1170344850 20:15373478-15373500 CACTGCATCCTGGAACTCCTGGG + Intronic
1172030547 20:31979288-31979310 TACTGAAGCCTGGAACTCTTGGG + Intronic
1172553288 20:35818609-35818631 AACTGTAGCCTGGTACTCTTGGG + Intronic
1179957202 21:44748176-44748198 CACTGCATCCTGGAACTCCTGGG + Intergenic
1183382516 22:37497212-37497234 AACTGAATCCAAGTACTGATTGG - Intronic
1184155935 22:42667184-42667206 AACTGAAACCAGCTACTCAGGGG - Intergenic
950310018 3:11948992-11949014 GACCCAATCCTGGCACTCATTGG - Intergenic
951505656 3:23442308-23442330 AAATGAATCCTGCTACTGATGGG + Intronic
954445877 3:50546640-50546662 AACTGAGTCCTGGTGCCCAGTGG - Intergenic
956811163 3:72865404-72865426 CACTGCATCCTGATACTCCTGGG + Intergenic
957574784 3:81993187-81993209 AACTGAAACTTTGTACTCTTTGG - Intergenic
958538431 3:95434531-95434553 AACTGACACCTGGTACAAATTGG - Intergenic
960665134 3:120101399-120101421 AACTAAATCTTGCTACTCTTAGG + Intergenic
960706364 3:120485892-120485914 AACTGAAACTTGGTACTTTTTGG + Intergenic
967773196 3:193357321-193357343 AACTGGATCCCCGTCCTCATGGG - Intronic
968325121 3:197806961-197806983 CACTGAAACCTGGAACTCCTGGG - Intronic
970218994 4:13788048-13788070 AACTGAAAGCTTTTACTCATGGG - Intergenic
971411650 4:26379253-26379275 CACTGCAGCCTGGTACTCCTGGG + Intronic
972462902 4:39322701-39322723 CACTGAAGCCTCGAACTCATGGG - Intronic
972813141 4:42612760-42612782 AACTGAAAACTGGTGCTTATTGG - Intronic
978047663 4:104151891-104151913 AACTAAGTCATGTTACTCATAGG - Intergenic
978246509 4:106578607-106578629 TACTGAATACTTGTACTCAGTGG + Intergenic
978386341 4:108179353-108179375 AACTGCTTCTTGGTACACATGGG + Intergenic
978838159 4:113178180-113178202 AACTGCAGCCTGGAACTCCTGGG - Intronic
979244109 4:118479261-118479283 TCGTGAATTCTGGTACTCATGGG - Intergenic
981783319 4:148450046-148450068 TACTGAATCCTCTTATTCATAGG + Intergenic
984598536 4:181699365-181699387 CACTGAAGCCTGGAACTCCTGGG - Intergenic
985275031 4:188229786-188229808 CACTGAATCCTTGAACTCCTCGG - Intergenic
988584846 5:32499432-32499454 AGCTGTAACCTGGAACTCATGGG + Intergenic
989572061 5:42954094-42954116 AACTGCATCCTGGACCTCCTGGG - Intergenic
990049233 5:51475893-51475915 AAATGAATCCTGGTGCTGAAAGG + Intergenic
990355520 5:54962528-54962550 CACTGAACCCTGGTCCTCTTGGG + Intergenic
990951567 5:61303879-61303901 CACTGCATCCTGGCACTCCTGGG + Intergenic
991284324 5:64954362-64954384 CACTGCAGCCTGGTACTCCTGGG + Intronic
992332318 5:75729962-75729984 AACTAATTCCTGTTAATCATAGG + Intergenic
993472719 5:88325453-88325475 CACTGCAACCTGGAACTCATGGG + Intergenic
993879116 5:93342341-93342363 CACTGAAGCCTGGAACTCCTGGG - Intergenic
994865753 5:105267567-105267589 CACTGAAGCCTGGGACTCCTGGG + Intergenic
995407123 5:111810968-111810990 AATTGATTCCTGGTGCTCACTGG + Intronic
997836562 5:137199025-137199047 AAATAAATCCTGATAGTCATTGG - Intronic
998812984 5:145985078-145985100 CACTGAAGCCTGGTCCTCCTGGG - Intronic
998932093 5:147192579-147192601 AAATGAATCCAAGTACTCACTGG - Intergenic
1001573914 5:172749275-172749297 AACTGAATCCAGGTTTTCCTGGG + Intergenic
1001666691 5:173439060-173439082 AACTGAAAGCTTGTACTCCTTGG + Intergenic
1002107946 5:176889380-176889402 CCCTGAATCCTGGTGCTCAGAGG - Exonic
1002117539 5:176975059-176975081 AACTGCAGCCTTGAACTCATTGG - Intronic
1002969616 6:2000735-2000757 TACTGCAGCCTGGAACTCATGGG + Intronic
1003161317 6:3636915-3636937 AACTGAATCCTGAGACACATGGG - Intergenic
1004246371 6:13980748-13980770 AAATGAATCCTGGTATCGATAGG + Intergenic
1006137439 6:31903731-31903753 AACTGAATTCTTGAACTCAAGGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1010176061 6:73029335-73029357 AGCTGAATCCAGGAATTCATGGG - Intronic
1012274877 6:97260973-97260995 AAATGAATCATGGTACCCATTGG - Intronic
1013142437 6:107350732-107350754 CACTGCATCCTGGAACTCCTGGG - Intronic
1014239392 6:118998269-118998291 AACTTAATCCAGGTCCTAATTGG + Intronic
1014624579 6:123710112-123710134 AACTGAATACTGGTCTTCATTGG + Intergenic
1015730639 6:136344401-136344423 AAGTGAATTCTGTTACTCATAGG + Intronic
1016764385 6:147775641-147775663 AACTGACTCCTGATCCTCCTTGG - Intergenic
1017495785 6:154982260-154982282 CACTGAAACCTGGAACTCCTGGG - Intronic
1018845006 6:167549552-167549574 GACTGACTTCTGGTAATCATTGG + Intergenic
1021724801 7:23538486-23538508 AACTGAAGCATGGAACTCCTGGG + Intergenic
1022493745 7:30840150-30840172 ATCTGACTCCTGGGACACATTGG - Intronic
1022713417 7:32874523-32874545 CACTGAAGCCTTGAACTCATGGG - Intronic
1024507960 7:50179105-50179127 AACACATTCCTGGCACTCATAGG + Intergenic
1026511910 7:71034412-71034434 AACTGAAGCCTGCTACTCAAGGG - Intergenic
1026994795 7:74608455-74608477 CACTGAAGCCTGGAACTCCTGGG + Intergenic
1028047145 7:86136089-86136111 ATCTGAATCCAGGAAATCATAGG + Intergenic
1029690983 7:102181285-102181307 AACTGAATCCTGGTACTCATTGG - Intronic
1029990082 7:104955142-104955164 TACTGTATCCTGGAACTCCTGGG + Intergenic
1030758189 7:113316174-113316196 GACTGAACCCTGCTACTCCTAGG + Intergenic
1030900955 7:115122654-115122676 AAGTGTCTCCTGATACTCATAGG + Intergenic
1032676949 7:134139284-134139306 ATCTGAAGCCTGCTACTAATAGG - Intronic
1032848238 7:135770174-135770196 CACTGAATCCTGGCACTCCTTGG - Intergenic
1034123494 7:148650052-148650074 CACTGAATCCAGGTACTCCCTGG - Intergenic
1037024439 8:14016118-14016140 AAATGAATGCTTATACTCATTGG - Intergenic
1037375811 8:18226404-18226426 AACTGAATCCTTTAACTCCTGGG - Intergenic
1038362082 8:26890309-26890331 AACTGAAACCCGGTAGTCATTGG - Intergenic
1038925487 8:32134804-32134826 CACTGTATCCTGGAACTCCTGGG - Intronic
1039477222 8:37845724-37845746 CACTGCAGCCTGGAACTCATGGG - Intronic
1041786347 8:61638665-61638687 AACTGGATCCTGGTGTTCATGGG + Intronic
1044536120 8:93357962-93357984 AACTGAATCCTGATACCACTTGG + Intergenic
1045448958 8:102300055-102300077 AACTGGATCCTGGTGGTCACTGG + Exonic
1046853937 8:119007773-119007795 AACTGATTTCTGGTACATATTGG - Intronic
1048159560 8:132002191-132002213 AATTGAATCTTGGTACTGAGTGG - Intronic
1048326628 8:133444044-133444066 AACTGAGTCCTGGTCTTCAGGGG + Intergenic
1049269686 8:141687741-141687763 TACTTAATCCTGATACTCAGTGG + Intergenic
1052439274 9:28473282-28473304 AATTGAATGCTGCTACTCATTGG - Intronic
1052744433 9:32426339-32426361 AACTCAATCCTGCTGCTCAGGGG - Intronic
1055370769 9:75596415-75596437 CACTGCATCCTGGAACTCCTGGG - Intergenic
1055434681 9:76280658-76280680 TACTGCAGCCTGGTACTCCTGGG - Intronic
1059902645 9:118945411-118945433 ATCTGAGTCCTGGTACTTAAGGG + Intergenic
1060513959 9:124254337-124254359 TACTGAATCCTGAAACTCTTTGG + Intergenic
1061560042 9:131396021-131396043 AGCTGGATTCTGGTCCTCATCGG + Intronic
1187231275 X:17425728-17425750 AACTGGATCCTGTTACTGCTGGG + Intronic
1196931397 X:120685117-120685139 AATTAAAACCTGGCACTCATAGG - Intergenic
1198329944 X:135613078-135613100 CACTGATCCCTGGTACTCATGGG - Intergenic
1198341729 X:135720673-135720695 CACAGATCCCTGGTACTCATGGG - Intronic
1198346265 X:135762689-135762711 CACAGATCCCTGGTACTCATGGG + Intronic
1198348171 X:135779974-135779996 CACAGATCCCTGGTACTCATGGG + Intergenic
1198350077 X:135797236-135797258 CACAGATCCCTGGTACTCATGGG + Intronic
1198351987 X:135814509-135814531 CACAGATCCCTGGTACTCATGGG + Intronic
1198353891 X:135831778-135831800 CACAGATCCCTGGTACTCATGGG + Intronic
1198355803 X:135849027-135849049 CACAGATCCCTGGTACTCATGGG + Intronic
1198357714 X:135866306-135866328 CACAGATCCCTGGTACTCATGGG + Intergenic
1198359627 X:135883589-135883611 CACAGATCCCTGGTACTCATGGG + Intronic
1198362112 X:135905761-135905783 CACTGATCCCTGGTACTCAGGGG - Intronic
1198362377 X:135908208-135908230 CACTGATCCCTGGTACTCATGGG - Exonic
1198362495 X:135909372-135909394 CACTGATCCCTGGTACTCAGGGG - Intronic
1198366483 X:135945367-135945389 CACAGATCCCTGGTACTCATGGG + Intergenic
1199091592 X:143699690-143699712 ACCTGAAACTTTGTACTCATTGG + Intergenic
1201289932 Y:12413394-12413416 CACTGAAGCCTGGAACTCCTGGG + Intergenic
1202187805 Y:22206345-22206367 CACTGCAGCCTGGAACTCATGGG - Intergenic
1202203555 Y:22380051-22380073 CACTGCAGCCTGGAACTCATGGG + Intronic