ID: 1029691572

View in Genome Browser
Species Human (GRCh38)
Location 7:102185574-102185596
Sequence CACACCCAGCTAATGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029691560_1029691572 22 Left 1029691560 7:102185529-102185551 CCTGCCCCAGCCTCCTGAGTAGC 0: 873
1: 80345
2: 178977
3: 211538
4: 145696
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691559_1029691572 25 Left 1029691559 7:102185526-102185548 CCTCCTGCCCCAGCCTCCTGAGT 0: 101
1: 5273
2: 12716
3: 29329
4: 43895
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691564_1029691572 17 Left 1029691564 7:102185534-102185556 CCCAGCCTCCTGAGTAGCTGGGA 0: 1407
1: 2931
2: 4100
3: 3640
4: 3218
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691565_1029691572 16 Left 1029691565 7:102185535-102185557 CCAGCCTCCTGAGTAGCTGGGAC 0: 735
1: 2494
2: 3923
3: 4416
4: 3568
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691562_1029691572 18 Left 1029691562 7:102185533-102185555 CCCCAGCCTCCTGAGTAGCTGGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691569_1029691572 -9 Left 1029691569 7:102185560-102185582 CCGGCACATGCTAACACACCCAG 0: 1
1: 2
2: 15
3: 66
4: 414
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691568_1029691572 9 Left 1029691568 7:102185542-102185564 CCTGAGTAGCTGGGACTGCCGGC 0: 13
1: 2325
2: 79580
3: 200080
4: 240864
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data
1029691566_1029691572 12 Left 1029691566 7:102185539-102185561 CCTCCTGAGTAGCTGGGACTGCC 0: 22
1: 1980
2: 48172
3: 168754
4: 225154
Right 1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029691572 Original CRISPR CACACCCAGCTAATGTTTTG GGG Intronic
No off target data available for this crispr