ID: 1029694281

View in Genome Browser
Species Human (GRCh38)
Location 7:102202762-102202784
Sequence TCCCCAAGCTGTGTGTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 431}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029694281_1029694286 -6 Left 1029694281 7:102202762-102202784 CCCGGGGACACACAGCTTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 431
Right 1029694286 7:102202779-102202801 TGGGGATGGCCCAAGCAGGGTGG No data
1029694281_1029694294 28 Left 1029694281 7:102202762-102202784 CCCGGGGACACACAGCTTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 431
Right 1029694294 7:102202813-102202835 CTATCATCCTTCCCTGGCTCAGG No data
1029694281_1029694284 -10 Left 1029694281 7:102202762-102202784 CCCGGGGACACACAGCTTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 431
Right 1029694284 7:102202775-102202797 AGCTTGGGGATGGCCCAAGCAGG 0: 1
1: 0
2: 3
3: 17
4: 136
1029694281_1029694285 -9 Left 1029694281 7:102202762-102202784 CCCGGGGACACACAGCTTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 431
Right 1029694285 7:102202776-102202798 GCTTGGGGATGGCCCAAGCAGGG No data
1029694281_1029694291 22 Left 1029694281 7:102202762-102202784 CCCGGGGACACACAGCTTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 431
Right 1029694291 7:102202807-102202829 GTTTCCCTATCATCCTTCCCTGG 0: 1
1: 0
2: 0
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029694281 Original CRISPR TCCCCAAGCTGTGTGTCCCC GGG (reversed) Intronic
900427738 1:2588130-2588152 GCCCCAGGCTGGGTGTGCCCAGG - Intronic
901183329 1:7356621-7356643 TCAGCAGGCTGTCTGTCCCCAGG + Intronic
901511390 1:9719776-9719798 TCCCCAAGCAGGGTCTCCCAGGG + Intronic
902498705 1:16893520-16893542 TCCCCAACCTTTTTGTCACCAGG - Intronic
902598055 1:17522431-17522453 TCACTTAGCTGTGTGGCCCCAGG - Intergenic
903022747 1:20405369-20405391 TTCCCAAGTCGTGTGTCCCAAGG - Intergenic
903703879 1:25270604-25270626 TCCCCAAGCTTTTTGGCACCAGG - Intronic
904320410 1:29694482-29694504 TCACCAGGCTGTGTGACCCTGGG - Intergenic
904434102 1:30483123-30483145 CGCCCATGCTGGGTGTCCCCTGG - Intergenic
905365646 1:37449815-37449837 TCGCCATGCAGTTTGTCCCCAGG - Intergenic
905998246 1:42400992-42401014 TCCCCAAGCTTTTTGACACCAGG + Intronic
906883088 1:49613874-49613896 TCCCCAAGCTTTTTGGCACCAGG - Intronic
907280440 1:53343825-53343847 ACCCCTAGCTGTGTGAACCCGGG + Intergenic
911695128 1:100882143-100882165 TCCCCAAGCTTTCTGGCACCAGG - Intronic
915717943 1:157962154-157962176 TTACCAAGCTGTGTGTCTTCAGG - Intergenic
917848849 1:179043093-179043115 TGCCCAAGCTGTTTGTACCAAGG + Intronic
918145666 1:181753625-181753647 TCCCCAAGCTGTGTCCTCCGTGG - Intronic
918524838 1:185453938-185453960 TCCCCAAGCTTTTTGGCACCAGG - Intergenic
920054762 1:203183886-203183908 TCCCAGAGCTGTGTGGCCTCAGG - Intronic
922456444 1:225777515-225777537 TCACCAAGCTGTGTGACAGCTGG + Intergenic
924201723 1:241667383-241667405 TCCCCAAGATTCCTGTCCCCTGG + Intronic
1063491577 10:6469148-6469170 GCCCCACACTGTGGGTCCCCAGG + Intronic
1063817287 10:9790171-9790193 TCCCCAGGGTGTGAATCCCCAGG + Intergenic
1064094895 10:12416981-12417003 GGCCCAAGCAGTGTGACCCCGGG - Intronic
1065060691 10:21897701-21897723 TCCCCAACCTTTTTGTCACCAGG - Intronic
1065102175 10:22341284-22341306 TCCCCAAGCGGGGTGTCCACCGG - Intergenic
1065102201 10:22341360-22341382 TCCCCTAGGTGCGTGTCCCGTGG - Intergenic
1066323368 10:34327902-34327924 TCCCTTAGCTATGTGTCCCCTGG - Intronic
1067814670 10:49464638-49464660 TCCCCATGCTGTGTGCAGCCTGG + Intronic
1068724344 10:60284440-60284462 TTCACAAGCTCTGTGTCCCTGGG - Intronic
1069788831 10:71006476-71006498 TGCCCAAGCTGTGTGGCCTCAGG - Intergenic
1070370447 10:75777303-75777325 TCCCAGAGCTGTGTGTCTCTGGG + Intronic
1070537989 10:77393646-77393668 TTCCCAAGATGGGTGTCCCAGGG + Intronic
1070830746 10:79416738-79416760 TGTCCAAGCTGTGTGACCCTCGG + Intronic
1072858958 10:98983072-98983094 TCCCCAACCTGTTTGGCACCAGG + Intronic
1073147455 10:101290160-101290182 TCCCCAGGCTGTGGGTCTCTCGG + Intergenic
1073478178 10:103767970-103767992 TGCCCCAGCTGTGTGACCTCAGG + Intronic
1073839249 10:107479682-107479704 TCCCCAAGCTTTCTGGCACCAGG + Intergenic
1075551696 10:123397338-123397360 ACCCAAAGCTGCTTGTCCCCAGG - Intergenic
1075734335 10:124654772-124654794 TCCCCCAGCTCTGAGTCCCTGGG + Intronic
1075883904 10:125880012-125880034 ACCCCAAAGTGTGTGGCCCCAGG + Intronic
1075897404 10:126008989-126009011 GCCCCCTGCTGTGTGTGCCCTGG + Intronic
1076296726 10:129391575-129391597 TCCCCCAGCTTTGTGTGCCCAGG - Intergenic
1076475449 10:130748600-130748622 TCCCCAAGCTCTGTGGCCTGTGG - Intergenic
1076710930 10:132333749-132333771 TCCTCAGGCTGTGTGCCCACAGG + Intronic
1077263959 11:1639800-1639822 TCCCCAAGCTGGGGGGCACCAGG + Intergenic
1077917156 11:6618889-6618911 CCCCCAGGCTGGGTGTCCCTGGG - Exonic
1077963204 11:7097323-7097345 TCCCCAAGCTTTTTGGCACCAGG - Intergenic
1078542839 11:12225217-12225239 TCCATAAGCTGTGTGTCCTTGGG + Intronic
1079185360 11:18231405-18231427 TCACTGAGCTTTGTGTCCCCAGG - Exonic
1079772442 11:24479213-24479235 TCCCCATGCTGTGTGACCTGGGG + Intergenic
1081294231 11:41365508-41365530 TCCCCAAGCTTTTTGGCACCAGG - Intronic
1081475107 11:43421889-43421911 TCCCCAACCTTTTTGTCACCAGG - Intronic
1083660200 11:64248534-64248556 AGCCCCAGCTGTGTGACCCCGGG - Intergenic
1083716504 11:64580395-64580417 TACCCAAGCTGTGTGGCCTTGGG - Intergenic
1083872377 11:65497063-65497085 GCTCCAAGCTTTGTGTGCCCTGG + Intergenic
1084268943 11:68019017-68019039 TCCCCGGGCTGTGTGGCCCTGGG + Intronic
1084479262 11:69409228-69409250 TCCACAAGGTGGGTATCCCCAGG - Intergenic
1084547765 11:69822866-69822888 TCTCCTGGCTGTGTGACCCCGGG - Intergenic
1084608036 11:70183962-70183984 CCACCTTGCTGTGTGTCCCCTGG - Intronic
1084741280 11:71140967-71140989 GCCCAAGGCTGGGTGTCCCCAGG + Intronic
1084913994 11:72414133-72414155 TCCCCAGGCAGTGTGTGCCAAGG + Intronic
1085280433 11:75326528-75326550 TGCCCAAGCTGTGTGGCCTTGGG - Intronic
1085793722 11:79518202-79518224 TTCCCTAGCTGTGTGTCCTTGGG - Intergenic
1087812777 11:102625983-102626005 TCCCCAATCTCTGTGTACTCTGG + Intergenic
1088610247 11:111569692-111569714 TAGCCAAGCTGTGTATCCCACGG + Intergenic
1089460257 11:118648869-118648891 TCCCCAGGTTGGGAGTCCCCTGG + Intronic
1089500603 11:118929408-118929430 CCCTCCAGCTTTGTGTCCCCAGG - Intronic
1091755339 12:3047655-3047677 TCCCCAACCTTTGTGGCACCAGG - Intergenic
1091879395 12:3964631-3964653 TCCCCAAAGTGTGGGTCTCCAGG + Intergenic
1092619782 12:10251477-10251499 TCCCCAAACTTTTTGGCCCCAGG + Intergenic
1092926153 12:13274422-13274444 TCTCCCAGCTGTGTGTGGCCTGG + Intergenic
1094301423 12:28968654-28968676 TTCACCAGCTGTGTGTCCTCAGG - Intergenic
1096728275 12:53583158-53583180 ACCCCCTGCTGTGTGGCCCCTGG - Intronic
1096783764 12:54005657-54005679 TCTCCAGGCTGTTTGACCCCTGG - Intronic
1098370090 12:69749402-69749424 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1100054294 12:90490573-90490595 TCCCCATGCTGTGTGCAGCCTGG + Intergenic
1101976754 12:109366124-109366146 TCCCCAACCTTTTTGTCACCAGG - Intronic
1102195318 12:111021321-111021343 TGCCCAGGCTGTGTGACCTCAGG + Intergenic
1103542328 12:121674775-121674797 TTCCCAAGCTGTGTGCCCACAGG + Intergenic
1103795132 12:123498151-123498173 CCCCTCAGCTGTGTGTCCTCAGG + Intronic
1104090720 12:125514822-125514844 TAACCCAGCAGTGTGTCCCCAGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106403501 13:29452838-29452860 TCCAGAAGCTGCTTGTCCCCAGG - Intronic
1108249569 13:48551096-48551118 TGCCCAAGCTGTTTGTGCTCAGG - Intergenic
1108320319 13:49282924-49282946 TCCCCAACCTTTGTGGCACCAGG - Intronic
1108380226 13:49847855-49847877 TCCCATAGCTGTGTGACCCTCGG + Intergenic
1109083123 13:57933212-57933234 TCCCCAACCTTTTTGTCACCAGG + Intergenic
1109200356 13:59423624-59423646 TCCCCAAGCTTTTTGGCACCAGG - Intergenic
1109863037 13:68225133-68225155 TCCCCAGGCTGTGTGCAGCCTGG - Intergenic
1112298755 13:98211481-98211503 TCCCCAACCTTTGTGGCACCAGG - Intronic
1112320920 13:98406840-98406862 TCCCCTAAATGTGTGTTCCCAGG + Intronic
1113779118 13:112965867-112965889 GTCCCAAGCCGTGTGTCCCAAGG - Intronic
1115942189 14:38622095-38622117 TCCCCATGCTGTGTGCAGCCTGG + Intergenic
1117161513 14:52994687-52994709 CCCCCAAGCTGTGTCTCACTAGG + Intergenic
1117240326 14:53825639-53825661 TCCCCAACCTTTTTGGCCCCAGG - Intergenic
1117535820 14:56702490-56702512 TCCCCAACCTTTGTGGCACCAGG + Intronic
1118678733 14:68217009-68217031 TCCCCAAGTCCTGTGTCCTCTGG + Intronic
1119159710 14:72442776-72442798 TACCCAAGCCGTGTGCCTCCTGG + Intronic
1119635948 14:76273551-76273573 CTCCAAAGCTGTGTGACCCCAGG + Intergenic
1119807284 14:77490525-77490547 GCCCCTAGCTGTGTGACTCCAGG - Intronic
1119952845 14:78763768-78763790 ATCCCCAGCTGTGTGTCCCAGGG - Intronic
1121029028 14:90642094-90642116 ACCCCAAGCTGTTTATCCCATGG - Intronic
1121604495 14:95230643-95230665 TCTCCCAGCTTTGTGTGCCCGGG + Intronic
1122150387 14:99722343-99722365 TTCACCAGCTGTGTGACCCCAGG - Intronic
1122267514 14:100553617-100553639 TCCCTTCTCTGTGTGTCCCCAGG + Intronic
1124290555 15:28449530-28449552 AGCCCGAGCTGTGTGTCACCTGG + Intergenic
1124292682 15:28468016-28468038 AGCCCGAGCTGTGTGTCACCTGG - Intergenic
1125332766 15:38598295-38598317 TCACCAAGCTGTGTTACCCCAGG + Intergenic
1125601654 15:40918847-40918869 GCCTCAGGCTGTGAGTCCCCTGG + Intergenic
1125933395 15:43615785-43615807 TCCCCACTCTGTCTGACCCCTGG - Exonic
1125946493 15:43715247-43715269 TCCCCACTCTGTCTGACCCCTGG - Intergenic
1126100463 15:45115508-45115530 TCCCCTAGCTGTCTGGCGCCTGG - Intronic
1126347135 15:47708099-47708121 TCTCCAAGCTGTATATCCTCCGG + Intronic
1126821705 15:52510783-52510805 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1127890104 15:63242795-63242817 TCCCCAACCTTTTTGTCACCAGG + Intronic
1128615100 15:69102825-69102847 TCCCCAAACTATTTTTCCCCTGG + Intergenic
1129702029 15:77773709-77773731 GGCCCAGGCTGTGTGACCCCAGG - Intronic
1129971423 15:79780869-79780891 TCCCCAGGCACTGTGTCCCAGGG - Intergenic
1130064655 15:80593819-80593841 CTCCCCCGCTGTGTGTCCCCAGG + Exonic
1130145583 15:81271586-81271608 ACCCCAGGCTGTCTGACCCCTGG + Intronic
1132205877 15:99985892-99985914 ACCCCCAGCTGTGGCTCCCCAGG + Intronic
1133400074 16:5479345-5479367 TCTCCTAGCTGTGTGGCCTCAGG - Intergenic
1133755301 16:8758245-8758267 TCCACTAGCTGTGTGACCTCGGG - Intronic
1134093028 16:11401666-11401688 TCCCTTAGCTCTGTGGCCCCGGG + Intronic
1134192825 16:12135672-12135694 TCCTGAAGCTGTGTTTCCTCTGG + Intronic
1134446124 16:14332865-14332887 TCCCCAAGCAGTGTGAACACAGG - Intergenic
1134478479 16:14596693-14596715 TCCCCAAGCTGGGAGTACACTGG - Intronic
1134664724 16:16010585-16010607 TCACTAAGTTGTGTATCCCCCGG - Intronic
1134690300 16:16186837-16186859 TCCCCAAGCTTTTTGGCACCAGG - Intronic
1134774339 16:16838808-16838830 TCCCACAGCTGTGCTTCCCCTGG + Intergenic
1135168799 16:20165029-20165051 TCTCCTAGCTGTGTGACCTCAGG - Intergenic
1136459044 16:30398547-30398569 TCCCCAGCCTGTGGGCCCCCAGG - Exonic
1137305880 16:47199612-47199634 TCCCCAACCTGTTTGGCACCAGG + Intronic
1137674644 16:50298275-50298297 TTCCCCAGCTTTGTGGCCCCAGG + Intronic
1139142776 16:64288166-64288188 TCCCCAAGCTAGGTTTACCCTGG - Intergenic
1139426158 16:66881016-66881038 TACCCCAGCTGGGTGCCCCCGGG - Intronic
1139493545 16:67300168-67300190 TCCCCCAGCAGTGTGCCCACTGG - Intronic
1139965046 16:70740727-70740749 TCCCCATCCTGTTTGCCCCCAGG + Intronic
1141201873 16:81904493-81904515 TCTACCAGCTGTGTGACCCCGGG - Intronic
1141326613 16:83065832-83065854 TTCCCCAGCTGTGTGTCCTGTGG - Intronic
1141733955 16:85840065-85840087 GCCCCATGCTGTGTGTCGCTGGG + Intergenic
1141756973 16:85997754-85997776 TCTCCAAGCTGGGGGTCCTCTGG - Intergenic
1141807302 16:86350220-86350242 TCGACAAGCTGTGTGTTCCAGGG + Intergenic
1141867084 16:86757789-86757811 TGCTCAAGCTGTGTGACCCTGGG + Intergenic
1142654938 17:1385499-1385521 TCCCCAACCTTTGTGGCACCAGG + Intronic
1143352092 17:6296528-6296550 TCTCCAAGCCCTGTGTCCCGAGG + Intergenic
1143367894 17:6420387-6420409 TCTCCAAGCAGTGCCTCCCCAGG - Intronic
1144879909 17:18425825-18425847 TCCCCAAGATGTGGCTCCTCGGG - Intergenic
1144906887 17:18643854-18643876 GCCCTAAGCTGGGTGTCCGCAGG - Intronic
1145063849 17:19748799-19748821 TCCCCAGCCTGTGGCTCCCCAGG - Intronic
1145834660 17:27945223-27945245 TCCCCAACCTGTTTGACACCAGG + Intergenic
1146163668 17:30572762-30572784 TCCCCAAGATGTGGCTCCTCAGG + Intergenic
1147364442 17:39951185-39951207 TCCCCAAGCAGTGGGTCACTGGG + Intergenic
1147580662 17:41625573-41625595 TCCCCAAGATGTGGCTCCTCAGG + Intergenic
1147602639 17:41755588-41755610 TCCCCAAGCACGGTGTGCCCTGG - Exonic
1147634797 17:41957219-41957241 TCCCCAAGCTTTTTGGCACCAGG + Intronic
1147675488 17:42202365-42202387 CTCCCCAGCTGTGTGTCCCCAGG - Exonic
1147690073 17:42309437-42309459 CTCCCCAGCTGTGTGCCCCCAGG + Exonic
1147816311 17:43213245-43213267 TCCCCAAGGTGAGTGGCCCAAGG + Exonic
1148455240 17:47807901-47807923 TCCCCAGGCTTTCTGTGCCCAGG - Exonic
1148904886 17:50905623-50905645 TCCACAGGCTGTTTGTTCCCAGG + Intergenic
1149588300 17:57808380-57808402 TCCCCAACCTTTGTGCCACCAGG - Intergenic
1149897522 17:60440553-60440575 TCCCCAACCTTTTTGTCACCAGG + Intergenic
1151363659 17:73603753-73603775 CCCACAAGCTGTGTGACCCCTGG - Intronic
1151888746 17:76939677-76939699 TCCCCACTCTGGGAGTCCCCAGG + Intronic
1152300777 17:79494353-79494375 TCCCCGAGCTGTGAGGCCCTGGG + Intronic
1152756748 17:82090237-82090259 TGTCCGAGCTGGGTGTCCCCGGG + Intronic
1154078562 18:11230557-11230579 TCCCCAAACTGTTTGGCACCAGG - Intergenic
1154273877 18:12942955-12942977 TTCCCAAGCTGTGTGTCTGGGGG + Intergenic
1155804317 18:30146442-30146464 TCCCCAAGATGTTTGGCCCTTGG - Intergenic
1156372939 18:36487823-36487845 TTTCCAGGCTGTGTGTCCTCTGG - Intronic
1156480375 18:37432529-37432551 TCCCCAATCTCTCTGCCCCCAGG - Intronic
1157133625 18:45032672-45032694 TCCCCAAGCTATGAGACCCTGGG + Intronic
1157330493 18:46700539-46700561 TCCCCAAGCTGAGGGTCAGCAGG - Intronic
1157375611 18:47161645-47161667 TCCCCAACCTTTGTGGCACCAGG + Intronic
1157965856 18:52207348-52207370 TGCTCCAGCTGTGTGTCCACTGG + Intergenic
1158412727 18:57222085-57222107 TGCCCCTGCTCTGTGTCCCCAGG + Intergenic
1158796168 18:60849016-60849038 TCCCCAACCTTTTTGTCACCAGG - Intergenic
1160078932 18:75704286-75704308 TCCCCCAGGTCTGTGTACCCCGG - Intergenic
1160474225 18:79167892-79167914 TTCCCAGGCTGTTTGTCCCAAGG + Intronic
1160745108 19:707810-707832 TCTCCAAGCTGTGTGACCCTGGG - Intergenic
1160878415 19:1308555-1308577 CCACCAGGCTGTGTGTGCCCAGG + Intergenic
1160881585 19:1323276-1323298 TGCCCAAGTTCTGTGACCCCGGG - Intergenic
1160979918 19:1812148-1812170 TCCCACTGCTGTGCGTCCCCGGG - Intronic
1161591164 19:5129733-5129755 GCCCCCACCTGTGTGTCTCCAGG - Intronic
1161640280 19:5418350-5418372 CCCACCAGCTGTGTGACCCCAGG - Intergenic
1162527256 19:11213480-11213502 GCCCCTTGCTGTGTGACCCCAGG + Intronic
1162866209 19:13549191-13549213 TCCAGAATCTGTGTGTCCTCAGG + Intronic
1163011454 19:14429107-14429129 TCCCCAACCTGTGAGGTCCCAGG - Intergenic
1163233950 19:16020445-16020467 TCCCTTCCCTGTGTGTCCCCTGG + Intergenic
1163474398 19:17516483-17516505 TCCCCAAGATGTGAGGACCCAGG - Intronic
1163842809 19:19621599-19621621 TCTCCAAGCTGTGTTTACCATGG + Intergenic
1164519496 19:28967732-28967754 CCACCAAGCTGTATGACCCCAGG - Intergenic
1164829291 19:31308453-31308475 TCCCCAAGCTGTGGGCTCCCTGG - Intronic
1164971884 19:32539739-32539761 TCCCCAGGCTGCGTTTCCCCGGG - Intergenic
1166067469 19:40368222-40368244 CCTCCCAGCTGTGTGACCCCAGG + Intronic
1167133709 19:47604248-47604270 TCCCCTAGTTCTGAGTCCCCCGG + Intergenic
1167470399 19:49672522-49672544 GCCCCCAGCAGTCTGTCCCCAGG - Intronic
1167966982 19:53156028-53156050 CCCCCGAGCTGGGAGTCCCCTGG - Intronic
1168492446 19:56822006-56822028 TGCCCAAGCTGTGTGGGTCCAGG + Intronic
926691308 2:15736044-15736066 TCGCTTAGGTGTGTGTCCCCTGG + Intronic
926995499 2:18730566-18730588 TCCCCAACCTTTTTGGCCCCAGG - Intergenic
927885282 2:26714444-26714466 TCCCCAAGCACTGTGTCCCAGGG - Intronic
928339264 2:30427395-30427417 TCCCCAAGCTTTGTGGTTCCTGG - Intergenic
928489323 2:31765048-31765070 CCACCAAGCTGTGTGGTCCCAGG - Intergenic
929578775 2:43068950-43068972 TCCCCAGGCTGTGGGTGGCCAGG - Intergenic
929959463 2:46485400-46485422 TCACTAAGCTGTGTATCCCCTGG + Intergenic
930317581 2:49816515-49816537 TCCCCAACCTTTTTGGCCCCAGG + Intergenic
931205394 2:60140974-60140996 TCCAGAAGCTGGGTGACCCCAGG + Intergenic
932580145 2:72988136-72988158 TCTCCCAGCTGGGTGCCCCCTGG + Intronic
933173957 2:79156266-79156288 GCCCCAGGCTCTGTGACCCCAGG - Intergenic
933758587 2:85659726-85659748 TCACCTGGCTGTGGGTCCCCAGG - Intronic
935001931 2:99026856-99026878 TCCCCAACCTTTTTGTCACCAGG + Intronic
935128949 2:100247209-100247231 TCCCTCAGCTGGGTGTCCACTGG - Intergenic
935985065 2:108664429-108664451 TCCACAAGCGGTGGGACCCCAGG + Intronic
936022667 2:109006623-109006645 TGGCCTAGCTGTGTGTACCCTGG + Intergenic
936084131 2:109455078-109455100 TGCCGATGCTGTGTGGCCCCAGG - Intronic
936137504 2:109908084-109908106 TCCACAAGCGGTGGGACCCCAGG + Intergenic
936207193 2:110463401-110463423 TCCACAAGCGGTGGGACCCCAGG - Intronic
936449654 2:112624623-112624645 TGCACCAGCTGTGTGGCCCCAGG + Intergenic
937087844 2:119183138-119183160 TGCCCAAGATGTGTGTGGCCTGG - Intergenic
937441643 2:121920495-121920517 TCACTCTGCTGTGTGTCCCCAGG + Intergenic
939254757 2:139728412-139728434 TCCCCAAGTTTTTTGTCACCAGG - Intergenic
940610062 2:155978893-155978915 TCCCCAAGCTTTTTGGCACCAGG - Intergenic
941769551 2:169330139-169330161 TCCCCAAGCTTTTTGGCACCAGG - Intronic
942262275 2:174180636-174180658 TCCTCAAGTTTTGTGTCCACAGG - Intronic
942456421 2:176141163-176141185 TACCCAAGCTCTGAGTCTCCAGG - Intergenic
943502266 2:188706693-188706715 TCCCCAACCTTTGTGGCACCAGG - Intergenic
943597328 2:189873942-189873964 TCCCCAAGCTTTTTGGCACCAGG - Intronic
947309061 2:228780476-228780498 TCCCCAAGAAGTGGTTCCCCAGG + Intergenic
947747317 2:232515264-232515286 TCCCCAGGTTGTGTGTGGCCTGG - Intergenic
947849377 2:233273072-233273094 TCCTCAAGCTGTCTTTTCCCTGG - Intronic
948306584 2:236952658-236952680 TCCCCAAGCTTTTTGGCACCGGG - Intergenic
948464151 2:238144259-238144281 TGCCCCAGCTGTGTGTCCGTGGG - Intronic
948998646 2:241598475-241598497 TCCCCAAACTTTTTGGCCCCAGG + Intronic
1168906321 20:1406821-1406843 TCACCAAGCAGTGTGTACCAAGG + Intergenic
1169116467 20:3069467-3069489 TCCCAAAGGTGTGGGTCCCCAGG - Intergenic
1169217156 20:3800580-3800602 CCTCCCAGCTGGGTGTCCCCAGG + Intronic
1170761437 20:19254706-19254728 AGCCCATGCTGTGTGTCCTCTGG - Intronic
1171379407 20:24722779-24722801 TCTCTAGGCTGTGTGTCTCCAGG + Intergenic
1172771003 20:37382656-37382678 TCTCCCCGCTGTGTGTCCCTAGG - Exonic
1172811431 20:37650930-37650952 TACCCAATCTGTGTTTGCCCTGG - Intergenic
1173051946 20:39571823-39571845 TCCCCAAGCTTTTTGGCACCAGG + Intergenic
1173176740 20:40770727-40770749 TGCCCTGGCTGTGTGTCCCCTGG - Intergenic
1173338998 20:42137272-42137294 ACCCCCAGCTCTGTCTCCCCAGG + Intronic
1174782507 20:53402755-53402777 TCCCCAACTTGTTTGTGCCCCGG - Intronic
1175142890 20:56873792-56873814 TCCCCAACCTTTGTGGCACCAGG + Intergenic
1175196972 20:57250963-57250985 CCCCCAAGCCGTGTCTCCACAGG - Intronic
1175211730 20:57362148-57362170 TCCCCAACCTTTGTGGCACCAGG - Intronic
1175284851 20:57831126-57831148 AACCCAAGCTGTGTGACCCTGGG + Intergenic
1175374491 20:58515021-58515043 TCCCCCAGATGTCCGTCCCCTGG + Intronic
1175947737 20:62566538-62566560 ACCCCAAGCTGTGTGGTGCCGGG + Intronic
1176153303 20:63604607-63604629 TTCCCAAGCTGTGTGCCCTTAGG - Intronic
1176269388 20:64227789-64227811 CCCTCAAGCTCTGTGACCCCAGG - Intronic
1177839251 21:26218114-26218136 TCCCCATGCTGTGTGCAGCCTGG + Intergenic
1178297384 21:31421653-31421675 TCCCCAAGCTTTTTATCACCAGG - Intronic
1179199628 21:39204643-39204665 TCCCCAAGCTTTCTGGCACCAGG + Intronic
1180260201 21:46663226-46663248 AAGCCAAGCTTTGTGTCCCCAGG + Intronic
1181570663 22:23766367-23766389 TCCCCAGCCTGGGTGTCCCAAGG + Intronic
1182028182 22:27136722-27136744 TTCCCAGGCTGTGTGGCCACTGG + Intergenic
1182072459 22:27473455-27473477 TTCACAAGCTGTGTGACCCTTGG + Intergenic
1182115309 22:27753074-27753096 TCCCAAAGCTGAGTGTCTCTGGG - Intronic
1182127437 22:27826319-27826341 TCTCCAAGCTGTGTGACCTTGGG + Intergenic
1183009073 22:34930003-34930025 TCACCAAGCTGTGGGCCCACTGG - Intergenic
1183426413 22:37741738-37741760 ACCCCAAGCTGTGCGACCTCAGG - Intronic
1183716466 22:39536067-39536089 TCACACAGCTGTGTGTCCACAGG + Intergenic
1183756545 22:39772063-39772085 TCCCCAAGCTTTTTGGCACCAGG + Intronic
1184235025 22:43178764-43178786 TCCCCCTGCTGTGTGACCCCTGG + Intronic
1184248264 22:43246423-43246445 CCCTCCAGCTGTGTGTGCCCAGG + Intronic
1184512626 22:44942359-44942381 TCCCCGAGCTGTGTGTTCCAGGG - Intronic
1184631563 22:45784650-45784672 GCTCTAAGCTGTGTGTCCTCTGG - Intronic
1184770732 22:46595131-46595153 CCCCCACCCTGTGTGTCTCCAGG - Intronic
1185182797 22:49372861-49372883 TCCCCACCCTCTCTGTCCCCAGG + Intergenic
1185345973 22:50310970-50310992 TCCCCCAGCCCTGTGTCCCCTGG + Exonic
1185372343 22:50466767-50466789 GCCCAGAGCTCTGTGTCCCCAGG + Intronic
950121008 3:10482609-10482631 TCCCTGACCTGTGTGTCCCTGGG + Intronic
950448226 3:13050385-13050407 ACCCCAACTTGTGTGTGCCCCGG + Intronic
950457121 3:13099485-13099507 CCCCCGAGCTGGGTGTCCCCGGG + Intergenic
950673348 3:14540135-14540157 TCCCCAAGCCCTGGGTCTCCAGG + Intronic
950674047 3:14544110-14544132 CCCACAAGCTGTGTGACCCTAGG + Intergenic
950676029 3:14555039-14555061 CCCCCAGGCTGTGTGACCCCAGG - Intergenic
950972212 3:17200597-17200619 TCCCCAACCTCTTTGTCACCAGG - Intronic
951459978 3:22940857-22940879 TCCCCAACCTGTTTGGCACCAGG - Intergenic
954155186 3:48681490-48681512 TCCCCAGGCTCAGTGTACCCAGG + Exonic
954731424 3:52665790-52665812 TCCCCAAGCTTTTTGGCACCAGG - Intronic
955022292 3:55132906-55132928 TCCCCAACCTTTGTGGCACCAGG - Intergenic
955616044 3:60807700-60807722 TCACCACCCTGTTTGTCCCCAGG + Intronic
955973254 3:64456891-64456913 TCCCAAAGCTCTGAATCCCCTGG - Intergenic
956903193 3:73737951-73737973 TCCACAAGCTGTGTGACCTTGGG - Intergenic
957091912 3:75739090-75739112 TCTCCAGACTGTGTCTCCCCAGG + Intronic
958133349 3:89457592-89457614 TCCCCAACCTGTTTGGCACCAGG - Intronic
958490098 3:94761648-94761670 GCCTCAAGATGTGTGTCCTCTGG + Intergenic
959048297 3:101498971-101498993 TCCCCAACCTGTTTGGCACCAGG - Intronic
961819500 3:129567981-129568003 TCCCCAAGCCCTCTGTCCACGGG - Intronic
961826223 3:129600540-129600562 TCCATAAGCTGTGTGTCCCAGGG - Intronic
962918403 3:139929431-139929453 TCCACAACCTGTGTGGCCCTGGG + Intergenic
963154601 3:142082455-142082477 TCCCCAACCTTTTTGGCCCCAGG - Intronic
964010416 3:151885671-151885693 TCCCCCAGGTGTCTGTCCCAAGG - Intergenic
964489234 3:157217310-157217332 TCCCCAAGATGTGACTCCACAGG - Intergenic
964539268 3:157761233-157761255 CCCCCAAGCTTTCTGTCACCTGG + Intergenic
964687612 3:159414684-159414706 TCCCCAACCTTTCTGTCACCAGG + Intronic
966802171 3:183774474-183774496 TCCCCAAGCTTTGTGGCACCAGG - Intronic
967100285 3:186210426-186210448 GCGCCAGGTTGTGTGTCCCCAGG - Intronic
967152004 3:186659295-186659317 TCCCCAGGCTGCTTGTCACCAGG + Intergenic
967250868 3:187536794-187536816 TCCCCAACCTTTGTGGCACCAGG + Intergenic
967408032 3:189138903-189138925 TCCCCAAGGAGTGTGGCCACAGG - Intronic
967819355 3:193826567-193826589 TGTCCAAGCTGTGAGTCCCCTGG - Intergenic
968311507 3:197687591-197687613 TGCCCAAGGTGTGCTTCCCCCGG - Intronic
968425297 4:519281-519303 TCGCCATGCTGTGTCTCCCCTGG + Intronic
968500167 4:946188-946210 CCCACATGCTGTGTGTCTCCTGG + Intronic
968651741 4:1762931-1762953 TCCCCGAGCTGTGGGTCACTAGG + Intergenic
969075963 4:4577903-4577925 TACTCATGTTGTGTGTCCCCAGG + Intergenic
969490217 4:7495406-7495428 CCCACCAGCTGTGTGTCCTCCGG + Intronic
969510254 4:7613617-7613639 TCCACAAGCAGTGTCTCCACGGG - Intronic
969614968 4:8247020-8247042 CCACCCAGCTGTGTGACCCCAGG + Intergenic
969896015 4:10305363-10305385 TCACTAAGGTGTTTGTCCCCAGG + Intergenic
969933586 4:10658598-10658620 TCCCCAAAGGGTGTCTCCCCAGG + Intronic
970222487 4:13825238-13825260 TCCCCATGCTGTGTGCACCTAGG + Intergenic
970569329 4:17364437-17364459 CTCACAAGCTGTGTGACCCCAGG - Intergenic
970763475 4:19518579-19518601 TCCCTAGGCTCTGTGTCCCAGGG + Intergenic
970869037 4:20793560-20793582 TCCCCAACCTTTGTGGCACCAGG + Intronic
971355361 4:25890386-25890408 TCACCTTGCTGTGTGTCCCCCGG + Intronic
971564516 4:28120472-28120494 TCCCCAACCTTTGTGGCACCAGG + Intergenic
976342340 4:83959206-83959228 TCCCCAAGCTTTTTGGCACCAGG + Intergenic
977352895 4:95910882-95910904 TCCCCTTGCTGTGTGGACCCTGG - Intergenic
980098467 4:128517845-128517867 GCCCTAAGCTATGTGTACCCAGG - Intergenic
980365666 4:131802116-131802138 TCCCCAACCTTTGTGGCACCAGG + Intergenic
980910875 4:138993151-138993173 TCCCCAACCTGTTTGGCACCAGG - Intergenic
982287940 4:153754255-153754277 TCCCCAACCTGCCAGTCCCCTGG - Intronic
982659891 4:158193955-158193977 TGACCAAGCTGTGGGACCCCTGG - Intergenic
982886354 4:160787794-160787816 TCCCCATGCTGTGTGCAGCCTGG + Intergenic
983251802 4:165354198-165354220 TCCCCAATCTTTTTGGCCCCAGG + Intergenic
983479916 4:168260473-168260495 TCCCCAACCTTTGTGGCACCGGG + Intronic
984179487 4:176464262-176464284 TCCCCAACCTTTGTGGCACCAGG + Intergenic
984900950 4:184585888-184585910 TCCCCAAGCTTTTTGACACCAGG - Intergenic
985575043 5:670065-670087 TTCCCAGGCTCTGAGTCCCCTGG + Intronic
985671017 5:1206725-1206747 TCCTCACGCTGCGTGTCCCTGGG - Intronic
986176678 5:5358570-5358592 TTCCCAACATGTATGTCCCCTGG + Intergenic
987433526 5:17865240-17865262 TCCCCATGCTGTGTGCAGCCTGG + Intergenic
988540663 5:32105957-32105979 TCCCCAAGCTTTTTGGCACCAGG + Intronic
989799109 5:45513785-45513807 TCCCCAACCTTTTTGTCACCAGG - Intronic
990536908 5:56732252-56732274 TACCCAAGCTGTTTGTCTGCAGG + Intergenic
990663754 5:58048856-58048878 TCCCCAGGCTGTTAATCCCCTGG - Intergenic
991340352 5:65601905-65601927 TCCCCATGCTGTGTGCAGCCTGG - Intronic
993467313 5:88265273-88265295 TCCCCAACCTTTTTGGCCCCAGG + Intronic
994819770 5:104634473-104634495 TCCCCAACCTTTTTGTCTCCAGG + Intergenic
995053989 5:107738826-107738848 TCCTCAAGATGTGTATCACCTGG + Intergenic
995453802 5:112331463-112331485 TCCCCCAACTGAGTGTTCCCTGG + Intronic
996832473 5:127755076-127755098 ACTCCAAGCAGTTTGTCCCCTGG - Intergenic
996926502 5:128833107-128833129 TCCCCAAGCTTTTTGGCACCAGG - Intronic
997998591 5:138606304-138606326 TCCCCAACCTCTCTGTCCTCAGG + Intergenic
998430156 5:142063712-142063734 TGCCCAAGCTGTGTGCCCTTTGG + Intergenic
999668163 5:153934704-153934726 TCCCCATGCTGTGTGCAGCCTGG - Intergenic
1000680251 5:164174689-164174711 TCCCCAACCTTTTTGTCACCAGG - Intergenic
1001587939 5:172845890-172845912 TTCAGAACCTGTGTGTCCCCAGG + Intronic
1002190830 5:177476705-177476727 ACACAAAGCTGTGTGTCTCCGGG - Intergenic
1002191248 5:177478853-177478875 TCCACCAGCTGTGTGCCTCCGGG - Intergenic
1002689569 5:181040869-181040891 TCCCCAAGCTGCAAGTCCGCAGG - Intronic
1002863644 6:1102071-1102093 CCCCCAAGCCATGTGTCTCCTGG + Intergenic
1002911022 6:1491100-1491122 TCCCCAAGCTGCCTGGGCCCAGG + Intergenic
1003087017 6:3068560-3068582 CGCCCCAGCTGTGGGTCCCCTGG - Exonic
1003914133 6:10769750-10769772 TCCACTAGCTGTGTGACCTCAGG + Intronic
1006620990 6:35363698-35363720 TCCCCCATTTTTGTGTCCCCTGG - Intronic
1006739425 6:36296779-36296801 CCCACAAGCTGTGTGACCTCCGG + Intronic
1006744062 6:36329432-36329454 TTCACAAGCTGTGTGGCCCAGGG - Intronic
1007251786 6:40500229-40500251 TCACCCAGCTCTGTGTCCCAGGG + Intronic
1008072287 6:47109871-47109893 TCTACTAGCTGTGTGACCCCTGG + Intergenic
1008459912 6:51756845-51756867 TCCCCAAGCTTTTTGGCACCAGG + Intronic
1008675199 6:53811744-53811766 TCTCCTAGCTGAGTGTCCCCAGG - Intronic
1011230789 6:85159620-85159642 TCCCCAACCTGTTTGGCACCAGG + Intergenic
1012245598 6:96923040-96923062 TGCCCAAGCTGAGTGTCTCAGGG - Intergenic
1012371504 6:98512806-98512828 TCTTCAAGCTGTGAGGCCCCGGG - Intergenic
1012429817 6:99152795-99152817 GCCCCAAGATTTCTGTCCCCTGG + Intergenic
1013951528 6:115788375-115788397 TCCCCAATCTGTTTCACCCCAGG - Intergenic
1014151484 6:118061682-118061704 TCCCCAACCTTTGTGGCACCAGG + Intronic
1016441162 6:144084810-144084832 TCCCCAACCTTTTTGGCCCCAGG - Intergenic
1016749689 6:147619047-147619069 TCCCAAAGCTGTGTGATCACAGG + Intronic
1016981731 6:149860843-149860865 ACCCCATGCTGTGTGACCCTTGG + Intronic
1018643716 6:165928998-165929020 CCCAGAAGCTGTGTGTCCCTGGG + Intronic
1018719053 6:166558532-166558554 ATCCCAAGCAGTGTGTGCCCAGG + Intronic
1018913264 6:168116557-168116579 TCCCCAAGCACTGTGCTCCCTGG + Intergenic
1020016660 7:4835471-4835493 TCTCAAAGCTGGGTGTCTCCTGG - Intronic
1020097497 7:5377032-5377054 CCCCCAAGCGGTTTGTCCTCGGG + Intronic
1021062840 7:16134454-16134476 TCCCCAACCTTTTTGTCACCAGG - Intronic
1021248733 7:18297145-18297167 TCCCTAAGCTTTTTGTCCCCAGG - Intronic
1021560270 7:21962479-21962501 TCCCCAACCTTTGTGGCACCAGG + Intergenic
1023339527 7:39205171-39205193 TCCCCAGGCTTTCTGTCCACAGG - Intronic
1023806397 7:43875956-43875978 TTCTCCAGCTCTGTGTCCCCAGG - Exonic
1023998070 7:45174179-45174201 CCCCAAAGCTGTGTGACCCTGGG + Intronic
1024275194 7:47671569-47671591 CCCCCAGGCTGTGTGCTCCCTGG - Intergenic
1024476126 7:49813344-49813366 TCCCCAAAGTGTGTTTCACCAGG - Intronic
1026112326 7:67468323-67468345 TCCCCAACCTTTGTGACACCAGG - Intergenic
1027655917 7:80930495-80930517 TCCCCAATCTTTTTGGCCCCAGG - Intergenic
1028768700 7:94589943-94589965 TCCCCAAGCTTTTTGGCACCAGG - Intronic
1029694281 7:102202762-102202784 TCCCCAAGCTGTGTGTCCCCGGG - Intronic
1029922769 7:104283270-104283292 CCACCAGGCTGTGTTTCCCCTGG + Intergenic
1030399768 7:109033899-109033921 TCCCCAACCTTTGTGGCACCAGG + Intergenic
1031299157 7:120042522-120042544 TCCCCATGCTGTGTGCAGCCTGG + Intergenic
1032053130 7:128662302-128662324 TCCCCAAGCTATGTGCAGCCTGG + Intergenic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1033278314 7:139988956-139988978 TCACCCAGCTGTCTGTGCCCGGG + Intronic
1033354100 7:140585574-140585596 TCACCAAGGTATGAGTCCCCTGG - Exonic
1033582146 7:142748058-142748080 TCTCCAAGCAGTGGGTCTCCTGG + Intergenic
1034982032 7:155485235-155485257 TCTCCTAGCTGTGTGCCCCTGGG + Intronic
1035560302 8:599274-599296 TCCCCAAGCTTTGTGGCACCAGG - Intergenic
1035693286 8:1573526-1573548 TCCCCAAGCTGTGAAACCCACGG - Intronic
1036586221 8:10126384-10126406 TTCCCAAGCTCTGTGGCACCAGG + Intronic
1036806809 8:11840497-11840519 TCCCCAAGCTTTTTGGCACCAGG - Intergenic
1037589564 8:20301795-20301817 GCCCCCAGCTGTGTGTGCCTGGG - Intronic
1039313859 8:36350346-36350368 TCCTCAAGCTGTGAGGCCCTTGG + Intergenic
1039909427 8:41812664-41812686 TCCCCAAGCTTTTTGGCACCAGG + Intronic
1039915633 8:41858479-41858501 ACCCCAAGCTGGGTGTCCACTGG + Intronic
1042318653 8:67451641-67451663 TCCCCAACCTTTGTGGCACCAGG - Intronic
1043250288 8:78064132-78064154 TCCCCAACCTTTGTGGCACCAGG + Intergenic
1043794618 8:84520875-84520897 TCCCCAAACTGTTTGGCACCAGG - Intronic
1046074802 8:109302477-109302499 TCCCCAGGCTGTGCCTCGCCAGG + Intronic
1048458724 8:134602088-134602110 TCCTCCAGCTGAGTGTCCCCAGG + Exonic
1048567210 8:135614237-135614259 TTCCGAAGCTGTGTATCCACAGG - Intronic
1048992708 8:139770654-139770676 TCCCCCAGCTCTGTGGCCTCAGG - Intronic
1050233047 9:3548880-3548902 ACACCAGGATGTGTGTCCCCTGG + Intergenic
1050289521 9:4139604-4139626 TCCCCAACCTTTTTGGCCCCAGG + Intronic
1051628673 9:19122880-19122902 TCCCCAAGCTTTATGGCACCAGG - Intronic
1052293168 9:26867196-26867218 TCCCCAAGCTTTTTGGCACCAGG - Intronic
1052738582 9:32371574-32371596 TCTCCAAGCTCAGTGTTCCCTGG - Intergenic
1053003565 9:34590611-34590633 TCCCCCGGCTGTGTGTCCTCGGG - Intergenic
1053630017 9:39927986-39928008 TCCCCAACCTTTGTGGCACCAGG + Intergenic
1053775756 9:41535546-41535568 TCCCCAACCTTTGTGGCACCAGG - Intergenic
1054213870 9:62322716-62322738 TCCCCAACCTTTGTGGCACCAGG - Intergenic
1056611316 9:88127725-88127747 TGCCCACGCTGTCTGTTCCCTGG - Intergenic
1057985275 9:99707122-99707144 TTCCCTAGCTGTGAGTCCCTGGG - Intergenic
1058026297 9:100144746-100144768 TCCCCAGGCTGCTTGTCGCCAGG - Intronic
1059051631 9:110932869-110932891 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1059800589 9:117745977-117745999 TCCCCAACCTTTGTGGCACCAGG + Intergenic
1060016911 9:120094665-120094687 CCCCCGCCCTGTGTGTCCCCTGG - Intergenic
1060187223 9:121571044-121571066 CCCCCAAGCTGTCTCCCCCCAGG + Intronic
1060664882 9:125426960-125426982 TCCCCTATCTGTGTGACACCAGG - Intergenic
1061627092 9:131847206-131847228 TCCCCAAGCTGTGCAGCCCAGGG - Intergenic
1061798981 9:133104017-133104039 TTCCCAAGTCGTGTGGCCCCTGG + Intronic
1061859081 9:133458976-133458998 TCCTCAAGCTGTGGGTGTCCCGG - Exonic
1061866706 9:133495029-133495051 ACCTCCAGCTGTGTCTCCCCAGG + Intergenic
1062011430 9:134269047-134269069 TTCACAAGCTGTGTGACCCTAGG + Intergenic
1062449798 9:136610660-136610682 GCCCCAGGCTGTGTGGCCCGAGG + Intergenic
1185837250 X:3356608-3356630 TCCCCAACCTTTTTGTCACCAGG + Intergenic
1186453890 X:9695697-9695719 TGCACCAGCTGTGTGTCCCTAGG - Intronic
1187328820 X:18316977-18316999 TCCCCAACCTTTTTGTCACCAGG - Intronic
1187450785 X:19394411-19394433 TCCACAAGCTGTGTGACTTCAGG - Intronic
1187651029 X:21406321-21406343 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1188913423 X:35879511-35879533 TTCCCAAGCTGTGTGCACCCTGG + Intergenic
1189500412 X:41551229-41551251 GCCCCAGGCTGTGTGTACCTGGG + Intronic
1190217371 X:48488961-48488983 ACCCCAGGCTGTGTGACCCTGGG + Intergenic
1190254621 X:48753359-48753381 TCCCCAATGTGTGTGACCCCAGG + Intergenic
1190513320 X:51195848-51195870 TCCCCATGCTGTGTGCAGCCTGG - Intergenic
1192330204 X:70169347-70169369 CTCCCAAGCTGGGTGGCCCCAGG + Intergenic
1194626025 X:96227581-96227603 TCCCCATGCTGTGTGCAACCTGG - Intergenic
1194818430 X:98474244-98474266 TCCCCAACCTTTCTGTCACCAGG - Intergenic
1194833351 X:98652573-98652595 TCACCAAGCTGTCTTTCTCCAGG + Intergenic
1195228073 X:102818430-102818452 TCCCCATGTTGTGTGTAGCCTGG - Intergenic
1195376458 X:104232722-104232744 TCTCCCAGCTGTTTGTTCCCGGG - Intergenic
1198189458 X:134287965-134287987 TGCCCAGGCTGTGTGTGCCAAGG - Intergenic
1198634102 X:138676554-138676576 TCCCCAAGCTATTTGGCACCAGG + Intronic
1198828267 X:140721334-140721356 TCCCCAACCTGTTTGGCACCAGG + Intergenic
1199010095 X:142747493-142747515 TCACCAAGCTGAATGTCACCAGG + Intergenic
1199741380 X:150739488-150739510 TCCCCAAACTGTATGTCCTAGGG + Intronic
1199886231 X:152024535-152024557 TCCCCAACCTTTGTGGCACCAGG - Intergenic
1201238914 Y:11938947-11938969 TACCCAACCTGTGTGACACCAGG - Intergenic