ID: 1029695927

View in Genome Browser
Species Human (GRCh38)
Location 7:102213202-102213224
Sequence TGTCCCTTGCAGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029695923_1029695927 -6 Left 1029695923 7:102213185-102213207 CCTCCTTTGGTGGAGATTGTCCC 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 163
1029695922_1029695927 -3 Left 1029695922 7:102213182-102213204 CCACCTCCTTTGGTGGAGATTGT 0: 1
1: 0
2: 2
3: 7
4: 166
Right 1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 163
1029695924_1029695927 -9 Left 1029695924 7:102213188-102213210 CCTTTGGTGGAGATTGTCCCTTG 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 163
1029695921_1029695927 -2 Left 1029695921 7:102213181-102213203 CCCACCTCCTTTGGTGGAGATTG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029695927 Original CRISPR TGTCCCTTGCAGATGGTGCA GGG Intronic
900745924 1:4360734-4360756 TGTGGCTTGCAGGAGGTGCATGG - Intergenic
901281047 1:8035299-8035321 TCTCCCTTTCAGATGCTGGAAGG - Intergenic
901857830 1:12055561-12055583 AGTCCCTGGCAGATGTCGCAGGG - Intergenic
902692878 1:18121167-18121189 TCACCCTTGCAGATGGGGGAAGG + Intronic
903886915 1:26546072-26546094 TGTCCCTTGCAGCAGGTGCCTGG + Intronic
903892197 1:26577326-26577348 TGTCCCTTGCTGGTGCTCCAGGG - Intergenic
904345127 1:29862897-29862919 TGGCCTTTGTAGTTGGTGCAGGG - Intergenic
905267444 1:36764632-36764654 TGTCCTTTCCAGAAGGTCCAGGG + Intergenic
906124864 1:43421582-43421604 TGTCACGTGGAGATGGGGCAAGG - Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
909543275 1:76814952-76814974 TGTCCCTTTCAGACAGTGCAGGG + Intergenic
915549287 1:156623455-156623477 TGTGCCCTGCAGACGGTGCCGGG + Exonic
915929516 1:160050866-160050888 TGACCCTTGCAGGAGCTGCAGGG - Intronic
917202727 1:172533777-172533799 TACCCCTTGGAGACGGTGCAGGG + Intronic
920437153 1:205954649-205954671 TGTCGCTTGGGGATGGGGCAGGG - Intergenic
921152909 1:212415791-212415813 TGTCCCTTGCAGCTGCAGCTTGG + Intergenic
922464637 1:225838713-225838735 AAGCCCTTGCTGATGGTGCACGG + Exonic
922855328 1:228770236-228770258 TGTCCCCTGCAGATCATGCATGG - Intergenic
923063649 1:230498929-230498951 TGTCCCTTGCTGCTGTCGCAGGG - Intergenic
1063417409 10:5885147-5885169 TGGCCCTTGCACCTGGTACAGGG + Intronic
1065498049 10:26350223-26350245 TGTCCCTTGCAACTGATGAATGG + Intergenic
1067046620 10:42988840-42988862 GGCCACTTGCAGATGGGGCAGGG + Intergenic
1067789564 10:49277550-49277572 TGTCCCTTGCAGATACAGCCTGG - Intergenic
1068852970 10:61765555-61765577 CATCCATTGCAGATGGTGGAGGG + Intronic
1069317270 10:67121790-67121812 TGTCCCTTTTAGATGGGACAAGG - Intronic
1069988340 10:72298897-72298919 CCACCCTTGCTGATGGTGCAGGG + Intergenic
1075679887 10:124324325-124324347 TGGCTCTGGAAGATGGTGCATGG - Intergenic
1075790484 10:125080712-125080734 TGGCCCTTCCAGATGGGCCATGG - Intronic
1076435398 10:130437864-130437886 TGCCCCTTGCAGAGGGTGAATGG + Intergenic
1077456356 11:2683627-2683649 TGTTCCTTGCAGCAGATGCAGGG - Intronic
1078707173 11:13755738-13755760 TGCACCTTGCAGATGTTGGATGG + Intergenic
1081932016 11:46878076-46878098 TCTCCCTAGGAGATGCTGCAGGG - Intronic
1083811502 11:65109173-65109195 TGTCCCTTGCAGAGGGGGCTGGG + Intronic
1084039288 11:66532059-66532081 TCTCCCTGGCTGATTGTGCAGGG - Exonic
1084715991 11:70873670-70873692 TGTCCTTTGCAGAGTGAGCAGGG - Intronic
1085459234 11:76683172-76683194 TGTCCCTAGCTGATGGAGGAAGG + Intergenic
1086060128 11:82691902-82691924 TGCCACTTTCACATGGTGCATGG - Intergenic
1088001770 11:104890513-104890535 TGTCTCTCCCAGATGGTGCTGGG - Intergenic
1088918853 11:114247138-114247160 TGTCCCCTGAAGAGGGGGCAGGG + Intronic
1089035802 11:115389738-115389760 TGTTCCTAGGAGATGGTTCATGG + Intronic
1091091692 11:132777044-132777066 TCTCCTTTGGTGATGGTGCATGG - Intronic
1094365462 12:29675107-29675129 TTTCCCTTGCAGATTCAGCATGG + Intronic
1096536807 12:52280050-52280072 TGGCCCTTGCAGATGGGGGCTGG + Intronic
1096624663 12:52887106-52887128 TGTCCCTTGCAGAGGATGCCAGG + Intergenic
1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG + Intronic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1103254721 12:119531220-119531242 TGTCCCTTGCAGTTGGAGTTGGG - Intronic
1103613702 12:122139221-122139243 AGCCACTTGCAGAAGGTGCAGGG + Intronic
1104186129 12:126433586-126433608 TGTGCCTTTCAGAGGGTGAAGGG - Intergenic
1105023656 12:132834630-132834652 TGTGCTTTGCAGAGGGAGCAAGG - Intronic
1105336000 13:19469810-19469832 TGTCCTTTCCAAATGGTTCACGG + Intronic
1109632833 13:65075462-65075484 TTTCCCATGCAAAGGGTGCATGG + Intergenic
1111818364 13:93183416-93183438 TGTGCTTTGCAGATGGAGGAAGG - Intergenic
1113515190 13:110889299-110889321 TGTTCATTTTAGATGGTGCAAGG - Intronic
1114777638 14:25502857-25502879 TGGCCATTGCAGAGGCTGCATGG - Intergenic
1115954440 14:38762437-38762459 CCTTTCTTGCAGATGGTGCATGG - Intergenic
1117499510 14:56338120-56338142 TGTCCAATGCAGATAGGGCAGGG - Intergenic
1119162662 14:72465920-72465942 TGTCCCTTTCAGACAGTGGAAGG + Intronic
1123491087 15:20783385-20783407 TGCCACCTGCCGATGGTGCACGG + Intergenic
1123547589 15:21352476-21352498 TGCCACCTGCCGATGGTGCACGG + Intergenic
1124624440 15:31300047-31300069 TTTCTCTTGCAGTTGATGCATGG - Intergenic
1129605118 15:77021029-77021051 TGCCCCTTGCAGAACGGGCAGGG + Intronic
1202955919 15_KI270727v1_random:79706-79728 TGCCACCTGCCGATGGTGCACGG + Intergenic
1133069236 16:3234907-3234929 TGTCCGTTGCTGAGGGAGCAAGG - Exonic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1134436465 16:14263143-14263165 TGTGCCTTCCAGACGGTTCAAGG + Exonic
1136995492 16:35186006-35186028 TGTCCCTCACAGGTGGGGCAGGG - Intergenic
1137575094 16:49594168-49594190 GTTCCCTTCCAGATTGTGCAGGG + Intronic
1138489168 16:57366217-57366239 TGTCCCTGTGAGATGGGGCAGGG + Intergenic
1138492216 16:57383209-57383231 TGTCCCTGGCAGGTGGAGAATGG - Exonic
1139307207 16:65997086-65997108 TGACCTTTGCAGAGGGTGAATGG + Intergenic
1141710812 16:85698009-85698031 TGGCTCTTGCCGATGGTCCACGG - Intronic
1142014877 16:87740105-87740127 TGTCCCCTGGAGAAGGTGCAGGG - Intronic
1142959473 17:3543442-3543464 TGAGCCTGGCAGAGGGTGCAGGG - Intronic
1148385714 17:47233233-47233255 TGCCCCTTGCAGATCCAGCAGGG - Intergenic
1149225030 17:54460073-54460095 TGTCCCTTGGTGTGGGTGCAGGG - Intergenic
1149362195 17:55907375-55907397 TGACTTTTGCATATGGTGCAAGG + Intergenic
1152196931 17:78923909-78923931 TGTCCAGGGCAGATGGAGCAAGG - Intronic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1156291572 18:35752612-35752634 TGTCACTTGCAGAGGGTCCCAGG + Intergenic
1161140232 19:2642897-2642919 TTTCCGGTGCACATGGTGCAGGG - Intronic
1161140304 19:2643273-2643295 TTTCCGGTGCACATGGTGCAGGG - Intronic
1162723550 19:12676366-12676388 CCTGCCTTGCAGATGGGGCAGGG - Intronic
1163969291 19:20776696-20776718 TGTCTCTCCCAGATTGTGCAGGG + Intronic
1164162249 19:22634745-22634767 TGTCTCTCCCAGATTGTGCAGGG + Intronic
1166346538 19:42169900-42169922 TGTGCCTTGCAGATGGGGAGGGG + Intronic
925570955 2:5312322-5312344 TGTTCCTTGCAAATGTTGCATGG - Intergenic
929542460 2:42832902-42832924 TGTCTCATGCAGTTGTTGCAAGG - Intergenic
929939820 2:46325057-46325079 TGACCTTTCCAGATGGAGCAGGG + Intronic
930024764 2:47023327-47023349 TGTGCTTTGAGGATGGTGCAGGG + Intronic
931265169 2:60654015-60654037 TGTCCCTGAAGGATGGTGCAGGG + Intergenic
932616859 2:73237540-73237562 TTTCCCTTACAGAAGGTGCCAGG + Intronic
936057783 2:109273750-109273772 TGTCCCTTTCATATGGTGACAGG + Intronic
936345777 2:111673788-111673810 TGCCCCTTGCACATGGGGCAGGG - Intergenic
939249789 2:139668842-139668864 TGACCTTGGCAGATGGGGCAGGG - Intergenic
939264499 2:139853683-139853705 TGTCCCAGGCAGAAGCTGCAAGG + Intergenic
944080928 2:195787763-195787785 TGTCCCCTGCAGCTGGGGCAGGG + Intronic
1170369232 20:15630710-15630732 TCTCCCTTGCATTTTGTGCACGG - Intronic
1174428044 20:50447307-50447329 TGCTCCTTCCAGATGGGGCAAGG + Intergenic
1175410054 20:58761874-58761896 TGTCCCTTCCCTTTGGTGCAGGG + Intergenic
1175410169 20:58762546-58762568 TGTCCCTTCCCTTTGGTGCAGGG + Intergenic
1175958671 20:62624124-62624146 TGTCCCTTGCAGATGCTGGTGGG - Intergenic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1179460793 21:41533707-41533729 TGTCCCTTTCCGATGCTGCATGG + Intergenic
1179820377 21:43933790-43933812 TGGCTCTTGCAGCTGGTGCTTGG - Intronic
1179914142 21:44465311-44465333 TGTCCCTCCCAGATGGGACAGGG + Intergenic
1180016226 21:45086548-45086570 TGTGCCTTGCAGATATTTCATGG + Intronic
1180038761 21:45265039-45265061 TTTCCCTGGGAGCTGGTGCAAGG - Exonic
1182051269 22:27314644-27314666 TGTCCTTTGCAGATGGACCAGGG - Intergenic
1183297926 22:37043133-37043155 TGTCCCATGGAGGAGGTGCATGG + Intergenic
1183515682 22:38264494-38264516 TGTCCCCTGCAGCTTGTGCAGGG - Intronic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
1184965783 22:47971088-47971110 TGTCCCCTGCAGAGGCTGAAGGG + Intergenic
1185365832 22:50436310-50436332 GACCCCGTGCAGATGGTGCAGGG - Intronic
949092195 3:41463-41485 AGTCCCTTGCAGATGGGTAAAGG + Intergenic
950471552 3:13189568-13189590 TGTCACTTGTAGTGGGTGCAGGG - Intergenic
950695774 3:14700100-14700122 TGTGCCTTGCAGCTGCTGCTGGG + Intronic
953240146 3:41141342-41141364 TTTCCCTTGGGCATGGTGCATGG - Intergenic
954831735 3:53426797-53426819 TGTCCCTTGCAGAAACTGGATGG - Intergenic
956547223 3:70418155-70418177 TTTCCCTTTCAGAAGGAGCAGGG + Intergenic
957070936 3:75567425-75567447 GGTCCCTTGCAGAAGGAGCTGGG + Intergenic
963120174 3:141769640-141769662 TGTCACTTGCAGAGCTTGCATGG - Intergenic
963819310 3:149870272-149870294 TTTTCCTTGCAGTTGGTGCTCGG + Intronic
964213543 3:154254356-154254378 TGTCTGTTGCAGATTTTGCATGG + Intronic
966406183 3:179600754-179600776 TGCCCCTTCTAGATGGAGCAGGG - Intronic
968661235 4:1799668-1799690 TGCCCCTCCCAGATGGGGCAGGG - Intronic
970111236 4:12640128-12640150 TGTCTGTTGCAGAAGGTGAAAGG + Intergenic
970576566 4:17434627-17434649 TGACCTTTGCAGATGGTGAAGGG - Intergenic
970886787 4:20995809-20995831 AGTCCCTTGCATATTTTGCATGG - Intronic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
973263120 4:48184998-48185020 TGTGCTTTGCAGATGGTAAAAGG - Intronic
973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976074591 4:81283219-81283241 TGACCCCTGCATATGGTGTAAGG + Intergenic
976388509 4:84485485-84485507 TGGCCCTTGCAGGTAGAGCATGG + Intergenic
986104843 5:4649937-4649959 TCTGCATGGCAGATGGTGCAGGG - Intergenic
986486260 5:8241521-8241543 TGTTCCATGCATATGTTGCATGG - Intergenic
990612031 5:57467341-57467363 TTACCCTTGTAAATGGTGCAGGG - Intergenic
990887341 5:60609573-60609595 TGTCACCTGCAGCTGGAGCATGG + Intronic
992256583 5:74927409-74927431 TGACTCTTTCAGGTGGTGCAGGG - Intergenic
998134914 5:139669460-139669482 TGTCACTTGCAGATGGCGGAGGG - Intronic
998668735 5:144329498-144329520 TGTCACTTTTAGATGCTGCAAGG - Intronic
999206180 5:149849783-149849805 GTCCCCTTGCAGAGGGTGCAGGG + Exonic
1001322383 5:170693271-170693293 TGTCCCTTCAAGATGGAGCCAGG + Intronic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002964580 6:1950829-1950851 TGTCCTGTCCAGATGGTTCATGG - Intronic
1003535400 6:6971425-6971447 TGTCACCTGCAGCTGGGGCATGG - Intergenic
1007217556 6:40252088-40252110 GGTCCCTTGCAGCTGGTGCCAGG - Intergenic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1007273631 6:40657618-40657640 TGCCCCTTTCAGCTGGGGCATGG + Intergenic
1011340885 6:86313167-86313189 TGTTCCTGGCAGAGGCTGCATGG + Intergenic
1013561149 6:111306270-111306292 TGTTCCTGGCAGAAGGAGCAGGG + Intronic
1015880746 6:137867771-137867793 TGTTCCTTTCAGATAATGCACGG + Intronic
1018357084 6:163029117-163029139 TGTGCTTTGTAGATGGAGCAAGG + Intronic
1019987993 7:4672136-4672158 TGTGCCCAGCACATGGTGCATGG + Intergenic
1020075223 7:5253396-5253418 TGTCCCTCGCAGTTGGTGTGGGG + Intergenic
1024603257 7:51005351-51005373 TGTACCTTGCCCATGGTGCCTGG + Intergenic
1024933146 7:54685796-54685818 TGGCCATAGCAGATGGGGCACGG + Intergenic
1025203852 7:56980169-56980191 TGTCCCTCGCAGTTGGTGTGGGG - Intergenic
1025668088 7:63596762-63596784 TGTCCCTCGCAGTTGGTGTGGGG + Intergenic
1026896072 7:74010745-74010767 TTTCCCAGGCAGGTGGTGCAGGG - Intergenic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG + Intronic
1029858651 7:103545319-103545341 TGTCCGTTTCAGATGGTACCAGG - Exonic
1030615867 7:111737834-111737856 TGTCACTTGATGATGCTGCAAGG - Intronic
1031119275 7:117703069-117703091 TCTGCCTTGCAGAAGGTGCTTGG - Intronic
1031870819 7:127088668-127088690 TGTCCATTGCACATGCTGTATGG - Intronic
1034240354 7:149605963-149605985 TGTCCCTTCCAGAGGTTGAAGGG - Intergenic
1036529530 8:9570673-9570695 TGTCCCTTGTAGATAATGAATGG + Intronic
1037753695 8:21698293-21698315 TGGCCCTTGCAGATGGCACTGGG + Intronic
1038356414 8:26832980-26833002 TGTCCCTTCCCTATGGTGCTGGG - Intronic
1039513977 8:38115934-38115956 TGTCCATTTCAGACTGTGCATGG + Intronic
1042525567 8:69761372-69761394 TGTGCCTTGAAGATGGAGGAAGG - Intronic
1042640492 8:70928655-70928677 TGTCCCTGGCTAATGGTGCAGGG - Intergenic
1043009003 8:74858379-74858401 TGTCCCTTACTGATGGATCAAGG - Intergenic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1051400915 9:16681388-16681410 TGTCCCTGGCAGATGTGGAAAGG + Intronic
1053174588 9:35912778-35912800 TCTCCCTTCCAGATCCTGCACGG - Intergenic
1059247987 9:112864602-112864624 TTTCCCTTGCACATGCTGCTGGG + Intronic
1061886150 9:133591958-133591980 TGGCCCTTTAAGATGGTGCCGGG + Intergenic
1062569520 9:137178721-137178743 TGTCCCTTGCAGCTTGTGGAGGG - Intronic
1188749891 X:33892590-33892612 TGTTTCTTGCAGATGGTTCTTGG + Intergenic
1188987674 X:36781912-36781934 TGGACCCTGCAGAAGGTGCATGG - Intergenic
1200877194 Y:8170101-8170123 TGTCCATAGCAGCTGGTGGATGG - Intergenic
1201920544 Y:19229161-19229183 GGTCCCATGCAGATGGTTGAGGG - Intergenic