ID: 1029696235

View in Genome Browser
Species Human (GRCh38)
Location 7:102215059-102215081
Sequence GAGGACACCCGGGCCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029696231_1029696235 -6 Left 1029696231 7:102215042-102215064 CCAGGAGGCTGAGGAGAGAGGAC 0: 1
1: 10
2: 150
3: 1020
4: 2620
Right 1029696235 7:102215059-102215081 GAGGACACCCGGGCCCCAGAGGG 0: 1
1: 0
2: 5
3: 54
4: 312
1029696230_1029696235 -5 Left 1029696230 7:102215041-102215063 CCCAGGAGGCTGAGGAGAGAGGA 0: 3
1: 62
2: 742
3: 2471
4: 6071
Right 1029696235 7:102215059-102215081 GAGGACACCCGGGCCCCAGAGGG 0: 1
1: 0
2: 5
3: 54
4: 312
1029696224_1029696235 14 Left 1029696224 7:102215022-102215044 CCTTAGCAGCACCTCTGAACCCA 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1029696235 7:102215059-102215081 GAGGACACCCGGGCCCCAGAGGG 0: 1
1: 0
2: 5
3: 54
4: 312
1029696227_1029696235 3 Left 1029696227 7:102215033-102215055 CCTCTGAACCCAGGAGGCTGAGG 0: 1
1: 52
2: 1026
3: 2950
4: 11470
Right 1029696235 7:102215059-102215081 GAGGACACCCGGGCCCCAGAGGG 0: 1
1: 0
2: 5
3: 54
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029696235 Original CRISPR GAGGACACCCGGGCCCCAGA GGG Intronic
900984848 1:6067102-6067124 GAGGAAGGCCGGCCCCCAGAAGG - Intronic
901506591 1:9689474-9689496 GAGGACGCCCCGCCCCCAGCCGG + Intronic
901795494 1:11677146-11677168 GAGAATGCCCGGGCCCCATAGGG + Intronic
901910434 1:12453098-12453120 GAGAACACCCAGGACCCAGTTGG + Intronic
902396980 1:16137766-16137788 AAACACACCCGAGCCCCAGATGG + Intronic
903220266 1:21865407-21865429 GAGGACACCCTGGCACCCCAGGG - Intronic
904170911 1:28591917-28591939 TTGGACACCAGGGCCCCAGAAGG - Intronic
906193136 1:43911775-43911797 GAGGATGGCAGGGCCCCAGAAGG - Intronic
906242458 1:44250464-44250486 GAGGACAGCAGAGCCCCAGGAGG + Intronic
912447761 1:109750764-109750786 GAGGACACTTGGGTCCCTGACGG - Exonic
914222340 1:145692256-145692278 AAGGACTCTCAGGCCCCAGACGG + Intronic
918118992 1:181521274-181521296 AAGGCCAGCTGGGCCCCAGAGGG - Intronic
920134284 1:203757046-203757068 GAGGAAACCCAGGTCTCAGAAGG + Intergenic
920744994 1:208617705-208617727 GAGGTCCCCCAGGCCCCAGGTGG - Intergenic
921075310 1:211695860-211695882 GAGGAAACCCAGGCTCTAGAGGG + Intergenic
922496485 1:226062197-226062219 GAGGAGACCCGGGCGGCAGTGGG - Intronic
923207233 1:231771006-231771028 CAGGACACCCTGGCCTCAGCCGG + Exonic
923220952 1:231892449-231892471 GAGGACACCAAGGCACCACAGGG - Intronic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
923724605 1:236495407-236495429 GAGGAAAGCAGGGCTCCAGAGGG - Intergenic
924648977 1:245905618-245905640 GAGGTCCCCCAGGCCCCAGGTGG - Intronic
1063115157 10:3067605-3067627 GACGACTCCCGGGCCCCCAAGGG + Exonic
1063857520 10:10271795-10271817 GAGGGCCCCAGGGCCCCACAGGG + Intergenic
1064144256 10:12815085-12815107 GAGGAAACCGAGGCCCCAGAAGG + Intronic
1067358831 10:45557736-45557758 GAGGCCACACGGGCTGCAGAAGG + Intronic
1067701991 10:48580442-48580464 GAGGCCACCCAGGCCACACATGG - Intronic
1067764867 10:49077163-49077185 GAGCACACCCCGACCACAGACGG - Intronic
1069780616 10:70953142-70953164 GAGGACAACCGGCCCTCAGCGGG - Intergenic
1070825543 10:79388383-79388405 GAGGGCACCCAAGCCCCAGATGG - Intronic
1071602394 10:86964722-86964744 GGGCACACCCAGGCCCCAGGTGG - Intronic
1071963067 10:90824894-90824916 GAGTTCCCCAGGGCCCCAGATGG - Intronic
1072467717 10:95682103-95682125 GAGGATAGCCTGGGCCCAGAAGG + Intronic
1073116600 10:101095006-101095028 GGGGACACTGGGGGCCCAGAAGG - Intronic
1074529271 10:114286067-114286089 GAGGACTCTCGGGCCCGAGTGGG + Exonic
1075871069 10:125773189-125773211 GAGCACCCCCGGGTCACAGATGG + Intronic
1077194041 11:1270478-1270500 AAGGACAGCAGGGCCCCAGCTGG - Intergenic
1077369065 11:2173105-2173127 GATGACACCCTGGGCCCAGCAGG + Intergenic
1077555194 11:3222574-3222596 GCCGACACCCGTGCCCCATAGGG - Intergenic
1080930595 11:36806012-36806034 CAATACACCAGGGCCCCAGAAGG + Intergenic
1081858298 11:46317445-46317467 GAAGACCCCCTGGCCGCAGACGG + Exonic
1083666070 11:64275430-64275452 GAAGACACTGGGGCCCCAAAGGG - Intronic
1083966473 11:66046835-66046857 TAGGACACCTGGGTCCCAGGAGG + Intronic
1083998716 11:66284619-66284641 GGTGACCCCCTGGCCCCAGATGG - Exonic
1084657367 11:70527312-70527334 GAGTCCAGCCCGGCCCCAGAAGG - Intronic
1084904758 11:72336971-72336993 GAGGACACTAGGAGCCCAGAAGG - Intronic
1084942003 11:72617941-72617963 GAGGGCAGGCGTGCCCCAGACGG - Intronic
1085127489 11:74011504-74011526 GAGCACTCCTGGGCCTCAGAGGG - Intergenic
1088367817 11:109057631-109057653 TAGGACACCCAGGTTCCAGATGG + Intergenic
1088847650 11:113681632-113681654 GGGGACACTCTGGCCCCTGATGG + Intergenic
1090967625 11:131612865-131612887 GATGACAACCAGGCCACAGAGGG - Intronic
1092057615 12:5521048-5521070 GAGGACAACCTGGCCCCACTGGG + Intronic
1095952226 12:47787837-47787859 GAGGACAGCAGAGTCCCAGAAGG + Intronic
1096182779 12:49559704-49559726 GAGGAGGCCTGGGCACCAGAAGG - Intronic
1096677496 12:53233525-53233547 GAGGACACCTGGCCCCCAGGGGG - Intergenic
1097616025 12:61885560-61885582 GAGGACACATGCTCCCCAGATGG - Intronic
1097895968 12:64825036-64825058 GAGGACCCCAGGGCTGCAGATGG + Intronic
1102097706 12:110253371-110253393 CAGGACACCCTGGCCCCAAAGGG + Intergenic
1104978198 12:132561434-132561456 GAGGGCAGCAGAGCCCCAGAAGG + Intronic
1106683342 13:32031175-32031197 GAGCACACCCGGGCCGCTCACGG + Intergenic
1108541749 13:51452536-51452558 GGGGACACCGGGGCCCGAGGTGG + Exonic
1109117568 13:58407909-58407931 GAGGACATCAGGGCCTGAGAGGG + Intergenic
1113104818 13:106760470-106760492 GAGGAGACCCTGGTGCCAGAGGG - Intergenic
1113786403 13:113004171-113004193 GAGGACACTTGTGCCCCGGAGGG - Intronic
1114032193 14:18587394-18587416 GTGGATACCTGGACCCCAGATGG + Intergenic
1114032873 14:18590926-18590948 GTGGACACCCAGTCCCCAGGTGG + Intergenic
1114075847 14:19160778-19160800 GTGGACACCCAGCGCCCAGATGG - Intergenic
1114076147 14:19162185-19162207 GTGGACACCCAGGCCCCAGGTGG - Intergenic
1114077664 14:19169973-19169995 GTGGACACCCAGTCCCCAGGTGG + Intergenic
1114086012 14:19237386-19237408 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1114086316 14:19238794-19238816 GTGGACACCCAGTGCCCAGATGG + Intergenic
1114493682 14:23118706-23118728 GAGGAGCCCCGGGGGCCAGAGGG - Exonic
1115821071 14:37212621-37212643 GAGGTCCCCCAGGCCCCAGGTGG - Intronic
1115918423 14:38343243-38343265 GAGTTCACCCAGGCCCCAGGAGG - Intergenic
1119477873 14:74941598-74941620 GAGGACACTTAGGCCCAAGAAGG - Intergenic
1121558670 14:94857933-94857955 GAGTCCACCCGGGCCTCAGTAGG - Intergenic
1121711169 14:96039849-96039871 GAGGGCTCCGGGACCCCAGAAGG - Intronic
1121731039 14:96187334-96187356 GAGGAAACCCATGCCCCAGTGGG + Intergenic
1121955602 14:98210100-98210122 GAGGTCACAGGGACCCCAGATGG - Intergenic
1122388950 14:101367519-101367541 GAGGACACAAGGCACCCAGAGGG - Intergenic
1202897095 14_GL000194v1_random:16576-16598 GAGGACACTCAAGCGCCAGAAGG + Intergenic
1202897857 14_GL000194v1_random:20413-20435 GTGGACACCCAGCGCCCAGATGG + Intergenic
1124820790 15:33044122-33044144 GAGGGCACCAAGGCCCCAGGGGG - Intronic
1125754180 15:42051160-42051182 GAGGCCATCCAGGCCCCTGAAGG + Exonic
1127525869 15:59791745-59791767 CAGGACACCCTGGCTGCAGAAGG - Intergenic
1128979366 15:72175341-72175363 GATCAGACCCGGGCCCCAGCTGG - Intronic
1129411833 15:75354623-75354645 GAGGAGACACGGGTCCCTGAGGG - Intronic
1130256699 15:82329183-82329205 GAGGGCACCCAGGCCACAGGTGG - Intergenic
1130598251 15:85260805-85260827 GAGGGCACCCAGGCCACAGGTGG + Intergenic
1131563823 15:93467604-93467626 GAGGACACTCAGGCACCATATGG - Intergenic
1131950100 15:97672835-97672857 GAGGTCACCCAGGCCCCAGGTGG + Intergenic
1133042247 16:3066900-3066922 GAGGACACCCCGGCCCACGCAGG + Intronic
1133207514 16:4242190-4242212 GAAGAAGCCCGGACCCCAGAAGG + Intergenic
1134081140 16:11325946-11325968 CAGGACACCCGGCCCCCAGCTGG + Intronic
1134108586 16:11500766-11500788 GAGGACACCGGGGCCCCGGGTGG + Intronic
1135396160 16:22133047-22133069 GAGGTCACCCGGGCTGCAGGTGG + Exonic
1136237606 16:28924588-28924610 GAGGACTCCCGGTCCCAGGAAGG - Exonic
1136284176 16:29231545-29231567 GAGGATCCCCGGGACACAGAGGG - Intergenic
1136284353 16:29232441-29232463 GAGGACACCCTGGACCCAGCAGG - Intergenic
1137275208 16:46928996-46929018 GAGGACGCCTGAGCCCCAGCGGG + Exonic
1138638216 16:58361368-58361390 GAGTTCCCCCGGGCCCCAGGTGG + Intronic
1139431176 16:66911823-66911845 GATGACCCCAGGGCCTCAGAGGG - Intronic
1139463895 16:67143533-67143555 GAGGAAACCAAGGCCCCAGGAGG - Intronic
1139587131 16:67911312-67911334 GAGGAAAGCTGGGCCACAGAAGG - Intronic
1141121589 16:81362743-81362765 GAGGAGAGCCGGGCACTAGAAGG - Intronic
1142089212 16:88201054-88201076 GAGGATCCCCGGGGCACAGAGGG - Intergenic
1142089386 16:88201953-88201975 GAGGACACCCTGGACCCAGCAGG - Intergenic
1142222932 16:88864299-88864321 GAGGACACCCAGGCTCCAGGGGG - Exonic
1142893612 17:2960650-2960672 GAGGACACTGGGGCCCCAGAAGG - Intronic
1143594815 17:7907720-7907742 CCGGACACCTGGGTCCCAGAGGG + Intronic
1143865053 17:9917452-9917474 GAGGGCTCCGGGGCCCCAGGGGG + Intronic
1144140456 17:12342484-12342506 CATGACACACGGGCCCCATAAGG + Intergenic
1144312151 17:14023798-14023820 GTTGACAACCAGGCCCCAGATGG + Intergenic
1144312207 17:14024055-14024077 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1144332609 17:14237521-14237543 GTTGACAACCAGGCCCCAGATGG - Intergenic
1145290587 17:21542598-21542620 GAGGACAGCGGGGTCCCAGGAGG - Intronic
1145302965 17:21653682-21653704 GTGGACACCCAGGTCCCAGGTGG + Intergenic
1145303134 17:21654427-21654449 GTGGACACTCGGGGCCCAGGTGG + Intergenic
1145303155 17:21654537-21654559 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1145346883 17:22047304-22047326 GTGGACACCCAGGCCCCAGGTGG - Intergenic
1145346904 17:22047414-22047436 GTGGACACTCGGGGCCCAGGTGG - Intergenic
1145347075 17:22048159-22048181 GTGGACACCCAGGTCCCAGGTGG - Intergenic
1145347284 17:22049049-22049071 GTAGACACCCAGGCCCCATATGG - Intergenic
1145900454 17:28487612-28487634 GAGGACACCAGGGTCCAGGAGGG + Intronic
1146844703 17:36175319-36175341 GGGGACACACCGGCCCCAGCAGG + Intronic
1146857009 17:36263254-36263276 GGGGACACACCGGCCCCAGCAGG + Intronic
1146863608 17:36325121-36325143 GGGGACACACCGGCCCCAGCAGG - Intronic
1146872919 17:36387164-36387186 GGGGACACACCGGCCCCAGCAGG + Intronic
1146880277 17:36438250-36438272 GGGGACACACCGGCCCCAGCAGG + Intronic
1146943481 17:36859525-36859547 GAGAAAACCGAGGCCCCAGAAGG + Intergenic
1147066468 17:37925709-37925731 GGGGACACACCGGCCCCAGCAGG - Intronic
1147075803 17:37987789-37987811 GGGGACACACCGGCCCCAGCAGG + Intronic
1147078000 17:38005270-38005292 GGGGACACACCGGCCCCAGCAGG - Intronic
1147087328 17:38067335-38067357 GGGGACACACCGGCCCCAGCAGG + Intronic
1147093936 17:38129205-38129227 GGGGACACACCGGCCCCAGCAGG - Intergenic
1147103273 17:38191298-38191320 GGGGACACACTGGCCCCAGCAGG + Intergenic
1147134105 17:38425455-38425477 GAGGAGACCCAGGCCCCTCAAGG + Intergenic
1148793544 17:50186705-50186727 GAGAACATCCGGAGCCCAGAGGG - Exonic
1149584276 17:57774911-57774933 GAGGACATCCAGGCCCCTGATGG + Intergenic
1149847847 17:60017767-60017789 GGGGACACACCGGCCCCAGCAGG + Intergenic
1150086203 17:62274384-62274406 GGGGACACACCGGCCCCAGCAGG + Intronic
1150644430 17:66969185-66969207 GAGGAGACTCTGGGCCCAGAGGG + Intronic
1151705418 17:75764713-75764735 GAGGAGCCCCAGCCCCCAGAGGG + Intronic
1152119724 17:78411138-78411160 CAGGAAACTCCGGCCCCAGACGG - Intronic
1152531832 17:80923366-80923388 GAGGACACCCCGGGCCCTGGTGG + Intronic
1152532016 17:80924291-80924313 GAGGGCACCTGGGCTCAAGAAGG + Intronic
1152587927 17:81197385-81197407 GAGGACAGCAGGGCTCCAGAGGG + Intronic
1152727063 17:81952729-81952751 AAGGACCCCCAGGCCACAGATGG + Exonic
1152779260 17:82219187-82219209 GAGGACACCCGGGACCAGGCAGG + Intergenic
1154202294 18:12308088-12308110 GAGGACGCGCGGGCGCCAGTCGG - Exonic
1158198020 18:54910116-54910138 CAGGACACCCTGGCTGCAGAAGG - Intronic
1160854801 19:1211952-1211974 GAGGACACCCAGGCCTCACATGG - Intronic
1161285239 19:3464958-3464980 GAGGCCAGCCGGGCTCCAGAGGG + Intronic
1161768662 19:6219978-6220000 GAGCACGCCCGGGGCTCAGAGGG + Intronic
1161797688 19:6396607-6396629 GAGGGCTCACGGGACCCAGAAGG + Intergenic
1164465234 19:28482205-28482227 GATGAAACCCGTGACCCAGAAGG + Intergenic
1165411798 19:35666626-35666648 GAGGACACCCGGGCTCCGGTGGG - Intronic
1166007356 19:39916600-39916622 CAGGCCACCTGGGCCCCAGTGGG - Intronic
1166251684 19:41575862-41575884 GAGGAGACCCAGGGCCCAGCTGG + Intronic
1167249524 19:48392795-48392817 CAGGACACCGGGGCCTCTGAGGG - Intergenic
1167367813 19:49064153-49064175 CTGGACACCCGGGTCCCTGAGGG + Intronic
1167612716 19:50515068-50515090 GGGGACACTCAGGCCCCAGCAGG - Intergenic
1167671227 19:50854954-50854976 GAAGACAACCGGGACCCACATGG - Exonic
1167772627 19:51530645-51530667 CAGGACGCCCGGGTCCCTGAGGG - Intronic
1168115681 19:54220392-54220414 GAGGGCACCCAGCCCTCAGAGGG - Intronic
1168118668 19:54240138-54240160 GAGGGCACCCAGCCCTCAGAGGG - Intronic
924999628 2:394558-394580 GAGGAGACGCGGGCCCCAGCGGG - Intergenic
925404445 2:3596883-3596905 GAGGGCACCCAGGCGCCCGAAGG - Intronic
925532753 2:4883377-4883399 GAGGTCGCCCGGGCCTCAGGGGG + Intergenic
926725947 2:15998062-15998084 GAGGCCACCTGGGAGCCAGAAGG - Intergenic
927886636 2:26722926-26722948 GAGGAAACCTGAGGCCCAGAAGG + Intronic
928442542 2:31304080-31304102 GAGGCCTCCCAGGCCCCAGCAGG - Intergenic
931221761 2:60295041-60295063 GAGGCCACCCTGGTCCCAGGTGG - Intergenic
931944061 2:67285422-67285444 GAGGACACTGGGAACCCAGAGGG - Intergenic
933178575 2:79204163-79204185 GAGGACACAGAGGTCCCAGAGGG + Intronic
934756223 2:96826724-96826746 GAGGACCCCCTGGCCTCAGGAGG + Intronic
937925757 2:127166260-127166282 GAGGCCTCCAGGGCCACAGAAGG + Intergenic
938490441 2:131758296-131758318 GTAGACACCCAGGGCCCAGATGG - Intronic
938491813 2:131765119-131765141 GTGGACACCCAGTCCCCAGGTGG + Intronic
938495753 2:131797223-131797245 GTGGACACCCAGTCCCCAGGTGG - Intronic
941069793 2:160943017-160943039 GAGAGCAGCCGTGCCCCAGATGG - Intergenic
946083237 2:217145266-217145288 AAGAACACCCTAGCCCCAGATGG - Intergenic
1169213003 20:3778073-3778095 GAGGGCACTCGGGCCCCAGCAGG + Exonic
1171112887 20:22500547-22500569 GAGGCCACCCGAGCTGCAGAGGG - Intergenic
1171413732 20:24963634-24963656 GAGGATGCCCGGGCCCCACCTGG - Exonic
1171520275 20:25770464-25770486 GTGAACACCCAGGCCCCATATGG + Intronic
1171520669 20:25772228-25772250 GTGGACACCCAGGCCCCAGGTGG + Intronic
1171556251 20:26084265-26084287 GTGGACACCCAGGCCCCAGGTGG - Intergenic
1171556644 20:26086029-26086051 GTGAACACCCAGGCCCCATATGG - Intergenic
1172213477 20:33217304-33217326 GAGGAGGCCAGGGCTCCAGAGGG - Intronic
1173613656 20:44388847-44388869 GTGGCCACCCGGGCCGCAGCTGG - Intronic
1174114321 20:48216439-48216461 GAGGAAACCCGGACAGCAGAGGG - Intergenic
1174331541 20:49823305-49823327 GAGGACACTGGGGCTCAAGAAGG + Intronic
1175483575 20:59328645-59328667 GAGGAAAACCGGGGCACAGAGGG + Intergenic
1175767655 20:61602290-61602312 GCAGACACCCGGTCCCCAGTAGG + Intronic
1176616084 21:9029055-9029077 GTGGACACCCAGTCCCCAGGTGG - Intergenic
1176616781 21:9032565-9032587 GAGGACACTCAAGCGCCAGAAGG + Intergenic
1176617541 21:9036402-9036424 GTGGACACCCAGCGCCCAGATGG + Intergenic
1176654411 21:9576751-9576773 GTGGACACCCAGGCCCCATATGG + Intergenic
1176654536 21:9577333-9577355 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1176654617 21:9577725-9577747 GTTGACACCCAGGGCCCAGATGG + Intergenic
1176707439 21:10126444-10126466 GAGGGCACTCAGACCCCAGATGG - Intergenic
1176707538 21:10126920-10126942 GTGGATACCCAGGCCCCAGGTGG - Intergenic
1176707604 21:10127268-10127290 GTGGACACCCAGGACCCAGATGG - Intergenic
1176708349 21:10131082-10131104 GAGGACACCCAAGTGCCAGAAGG - Intergenic
1176709074 21:10134682-10134704 GTGGACACCCAGTCCCCAGGTGG + Intergenic
1179231547 21:39508071-39508093 GAGGACACTGAGGCCACAGAGGG - Intronic
1179430465 21:41317524-41317546 GTGGACACCAGGACCCGAGATGG - Intronic
1180291547 22:10853942-10853964 GTGGACACCCAGCGCCCAGATGG - Intergenic
1180291955 22:10855807-10855829 GTGGACACCCAGGCCCCAGGTGG - Intergenic
1180456307 22:15514451-15514473 GTGGATACCTGGACCCCAGATGG + Intergenic
1180456989 22:15517983-15518005 GTGGACACCCAGTCCCCAGGTGG + Intergenic
1180494352 22:15883364-15883386 GTGGACACCCAGCGCCCAGATGG - Intergenic
1180494759 22:15885229-15885251 GTGGACACCCAGGCCCCAGGTGG - Intergenic
1180940794 22:19658573-19658595 GTGGACACTCAGGCCCCAGGTGG + Intergenic
1180940825 22:19658691-19658713 GTGGACACAAGGCCCCCAGATGG + Intergenic
1180988477 22:19919510-19919532 CAGGACACCCGGCTCCCATAGGG + Intronic
1181506720 22:23363400-23363422 GTGGCCACTCGGGCCCCACAAGG - Intergenic
1182441732 22:30368624-30368646 GAGGACACCTTGGCCAGAGAGGG + Intronic
1183890808 22:40926987-40927009 CAGGACACCAGTGCCCCTGAGGG - Exonic
1184348031 22:43924975-43924997 GAGGCTACCCAGCCCCCAGAAGG - Intronic
1184835207 22:47016894-47016916 GAGGCTCGCCGGGCCCCAGAGGG - Intronic
1185039400 22:48496756-48496778 CAGGAAACCAGGGCCCCTGATGG - Intronic
1185126604 22:49014682-49014704 GAGGACAGCCGACCCTCAGAGGG - Intergenic
1185375980 22:50482734-50482756 GAAGACACTCGGGCCCCCGCAGG + Exonic
1185415152 22:50705604-50705626 GACCACACCCTGGCCCCACAAGG + Intergenic
950577047 3:13838218-13838240 GTGGAGACCCAGGGCCCAGAGGG + Intronic
950613414 3:14140302-14140324 GAGGAAACCAAGGCTCCAGAAGG - Intronic
950725947 3:14917205-14917227 GAGAGGACCCTGGCCCCAGAAGG - Intronic
951819286 3:26790728-26790750 GAGGTCCCCCAGGCCCCAGGTGG + Intergenic
952929340 3:38347200-38347222 CAGGACCCCCGGTGCCCAGAGGG + Intronic
953137924 3:40199553-40199575 GAGAACACTGGGGCTCCAGAAGG + Intronic
954144359 3:48626985-48627007 GAAGACTCCAAGGCCCCAGATGG - Exonic
959202672 3:103269057-103269079 GATGAAACCCGTGACCCAGAGGG - Intergenic
961616133 3:128182711-128182733 GAGGACACCCAGGTTCCAGCAGG - Intronic
962285843 3:134085000-134085022 GAGGACACTAGGTCCCCAGGAGG + Intronic
962756696 3:138470274-138470296 GAGGACACTGAGGCCCCACAAGG + Intronic
964209227 3:154209842-154209864 GAGGTCCCCCAGGCCCCAGGTGG + Intronic
966713109 3:182989504-182989526 GTGGACAGCCTGGCCACAGAAGG + Intergenic
966941779 3:184752498-184752520 GAGAAAACCCAGGCCCCCGAGGG - Intergenic
967976878 3:195040488-195040510 GAGGACACTGAGGCCTCAGAGGG + Intergenic
968467642 4:760502-760524 GAGGACACCAGGGGTACAGACGG - Intronic
968654963 4:1774502-1774524 GAGGGAACCCAGGCCCCAGAAGG + Intergenic
968656408 4:1780192-1780214 GAGGCCAGCTGGGCCCCCGAGGG - Intergenic
969052244 4:4381265-4381287 GAGGAAACGCAGGCCACAGAGGG + Intronic
969252072 4:5974536-5974558 GACGACACTGAGGCCCCAGAGGG + Intronic
969304831 4:6319630-6319652 GAGGTCACCCGGCCCCTACAGGG - Intergenic
969344351 4:6562032-6562054 GAGGACACCTGGGACAGAGAAGG + Intronic
969778932 4:9381139-9381161 GGGGGCACCCGGGGCCCAGAGGG + Intergenic
974079275 4:57195734-57195756 TAGGACCGCCTGGCCCCAGAAGG - Intergenic
980158235 4:129132294-129132316 GAGGATCCCTGGGCCCCAGGAGG - Intergenic
986199958 5:5571180-5571202 GAGGAGACTGAGGCCCCAGAGGG - Intergenic
986438571 5:7759002-7759024 GATGCCACCTGGACCCCAGATGG + Intronic
989290222 5:39755496-39755518 GAGGTCACCCTGGCCATAGATGG - Intergenic
991205322 5:64042826-64042848 AAGGTCACCCAGGCCTCAGATGG - Intergenic
996749581 5:126875242-126875264 AAGCACACCTGGGCCCCAGGAGG - Intronic
997782975 5:136678373-136678395 GAGGACACCAGTGCCACACAGGG - Intergenic
998169474 5:139864092-139864114 GAGGACAGCTGGGCCCCATGAGG - Intronic
998370183 5:141655808-141655830 GAGGACAGCTGGGCCCCAGGGGG + Intronic
1001981836 5:176043533-176043555 AAGGACACCTGGGCCCCAGGTGG - Intergenic
1001981924 5:176043870-176043892 GTGGACACCCAGGACCCAGGTGG - Intergenic
1001982638 5:176047200-176047222 GGTGACACCCAGGCCCCAGATGG - Intergenic
1002234825 5:177796857-177796879 GGTGACACCCAGGCCCCAGATGG + Intergenic
1002235542 5:177800187-177800209 GTGGACACCCAGGACCCAGGTGG + Intergenic
1002235627 5:177800524-177800546 AAGGACACCTGGGCCCCAGGTGG + Intergenic
1002299380 5:178248738-178248760 GAGGAAACCGAGGCCCCAGGAGG + Intronic
1002902910 6:1424711-1424733 GAGGACACCAAGGCACCAGGAGG - Intergenic
1003962082 6:11218289-11218311 GTGGAAAGCAGGGCCCCAGATGG - Intronic
1006436069 6:34026775-34026797 GGTGACACCCTGGCCCCAAAGGG - Intronic
1009833011 6:68963201-68963223 GAGGACACCAAGGCCCAAGTCGG - Intronic
1010343292 6:74781989-74782011 GAGTCCCCCCAGGCCCCAGATGG - Intergenic
1012910148 6:105109048-105109070 GAGGACACCTGAGCCCGAGGAGG - Intronic
1014947705 6:127516430-127516452 GCGGCCACCCGGTCCCCAGTGGG - Exonic
1016393822 6:143601703-143601725 GTGGACTCCTGGGTCCCAGATGG + Intronic
1016745510 6:147575194-147575216 GAGGACAACAGGGCCATAGATGG - Intronic
1016777744 6:147923776-147923798 GATGACACCTGGGCCCCTGATGG + Intergenic
1018899767 6:168045252-168045274 GAGGCCACCCTGGGCCCTGAAGG + Intergenic
1019422079 7:955126-955148 GAGGCCACACAGGGCCCAGACGG + Intronic
1019650138 7:2152367-2152389 GAGGGCACAGGGGCACCAGAAGG + Intronic
1020142823 7:5621930-5621952 GAGAACACCCGGGGCACACACGG + Intronic
1021333803 7:19373045-19373067 GATTACAGCAGGGCCCCAGAAGG + Intergenic
1023808298 7:43890717-43890739 GTGGACACCCTGGACCCTGAGGG - Intronic
1025280770 7:57625419-57625441 GTGGACACCCAGGCCCCATATGG + Intergenic
1025281159 7:57627191-57627213 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1025303570 7:57838316-57838338 GTGGACACCCAGGCCCCAGGTGG - Intergenic
1025303960 7:57840088-57840110 GTGGACACCCAGGCCCCATATGG - Intergenic
1025813433 7:64889427-64889449 GAGGCCACCCGAGCCCGAGTGGG - Intronic
1026100188 7:67378165-67378187 GAGGACACCCGGGCTGCACACGG + Intergenic
1026846323 7:73700851-73700873 GGGGGCACCCGAGCTCCAGAGGG + Intronic
1027044911 7:74984749-74984771 AAGGAAACCGAGGCCCCAGAGGG + Intronic
1029387945 7:100256172-100256194 AAGGAAACCGAGGCCCCAGAGGG - Intronic
1029581588 7:101439954-101439976 GAGGACACCAGGCTCCAAGAGGG - Intronic
1029696235 7:102215059-102215081 GAGGACACCCGGGCCCCAGAGGG + Intronic
1031970409 7:128061027-128061049 GAGGCCACCCTGGCCCCACTGGG + Intronic
1032387510 7:131534599-131534621 GAGGAAAGCCAGGCCCAAGAGGG - Intronic
1033538448 7:142333595-142333617 GAGGACGCCCCGGGCACAGATGG + Intergenic
1034260773 7:149753949-149753971 GAGGCCACCCATGCCCCACAGGG - Intergenic
1034543745 7:151776577-151776599 GGGTACACACGGGCCCCAGCAGG + Intronic
1034676186 7:152894409-152894431 GAAGGCACCCGGCACCCAGAGGG - Intergenic
1034960510 7:155361631-155361653 GAGGGCACCCAGGCCCCAGAAGG + Intronic
1036104154 8:5822504-5822526 GAGCACACCCGGGCACGGGAGGG + Intergenic
1036614757 8:10379586-10379608 GAGGAGACCAGGGTGCCAGAGGG - Intronic
1037493837 8:19420278-19420300 GACGACACATGGGCCCGAGAGGG + Intronic
1037710468 8:21351359-21351381 CAGGCCACCCATGCCCCAGATGG + Intergenic
1038450757 8:27637504-27637526 GAGGACAACGGGGCCGAAGAGGG - Intronic
1038455767 8:27671131-27671153 GAGGACAGCCAGGCCCAAAAGGG + Exonic
1039419452 8:37423828-37423850 GAGGAGCCCCAGGCCCCAAAGGG + Intergenic
1039476374 8:37841338-37841360 GGGGACGCCCGGGCCCCCGGAGG + Exonic
1039701142 8:39962963-39962985 GATGAAACCCGTGACCCAGAGGG - Intronic
1039806280 8:41002400-41002422 AAGGGCACCCGGGCCCCAGCAGG - Intergenic
1040769048 8:50950790-50950812 GAGGACATGCGTGCCCCACAGGG + Intergenic
1040942066 8:52844212-52844234 GAGGACAACCGGGCACCAGAGGG - Intergenic
1040975905 8:53194441-53194463 GATGACACACAAGCCCCAGATGG - Intergenic
1042238745 8:66641017-66641039 GTGGCCCCCAGGGCCCCAGAGGG - Intronic
1044941579 8:97349102-97349124 GAGGGCACCATGACCCCAGAAGG - Intergenic
1045590029 8:103582841-103582863 GAGGTCCCCCAGGCCCCAGGTGG - Intronic
1048551069 8:135433917-135433939 GAGGAAACCCAGGCCCCAGAAGG + Intergenic
1048801010 8:138193810-138193832 GAGGAATCCCAGGCCCCAGAGGG + Intronic
1049197416 8:141323363-141323385 GGGGCCACCGGGGCACCAGATGG + Intergenic
1049423933 8:142528950-142528972 GCACACACTCGGGCCCCAGAGGG - Intronic
1049651241 8:143771018-143771040 GCGGAGCCCAGGGCCCCAGAGGG - Intergenic
1053576273 9:39359184-39359206 GTTGGCACTCGGGCCCCAGATGG - Exonic
1053644633 9:40113182-40113204 GAGGGCACTCAGACCCCAGATGG - Intergenic
1053644734 9:40113657-40113679 GTGGATACCCAGGCCCCAGGTGG - Intergenic
1053644800 9:40114005-40114027 GTGGACACCCAGGGCCCAGATGG - Intergenic
1053646045 9:40120201-40120223 GTGGACACCCAGTCCCCAGGTGG + Intergenic
1053759671 9:41343339-41343361 GTGGACACCCAGTCCCCAGGTGG - Intergenic
1053760884 9:41349441-41349463 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1053761185 9:41350846-41350868 GTGGACACCCAGGGCCCAGATGG + Intergenic
1053761250 9:41351194-41351216 GTGGATACCCAGGCCCCAGGTGG + Intergenic
1053761349 9:41351669-41351691 GAGGGCACTCAGACCCCAGATGG + Intergenic
1054097842 9:60917875-60917897 GTTGGCACTCGGGCCCCAGATGG - Intergenic
1054119244 9:61193505-61193527 GTTGGCACTCGGGCCCCAGATGG - Exonic
1054325656 9:63711062-63711084 GAGGGCACTCAGACCCCAGATGG - Intergenic
1054325754 9:63711537-63711559 GTGGATACCCAGGCCCCAGGTGG - Intergenic
1054325821 9:63711885-63711907 GTGGACACCCAGGGCCCAGATGG - Intergenic
1054349958 9:64012391-64012413 GTGGACACCAAGGGCCCAGATGG + Intergenic
1054538525 9:66255775-66255797 GTGGACACCCAGTCCCCAGGTGG - Intergenic
1054539776 9:66261964-66261986 GTGGACACCCAGGGCCCAGATGG + Intergenic
1054539842 9:66262312-66262334 GTGGATACCCAGGCCCCAGGTGG + Intergenic
1054539943 9:66262787-66262809 GAGGGCACTCAGACCCCAGATGG + Intergenic
1054588509 9:66989057-66989079 GTTGGCACTCGGGCCCCAGATGG + Intergenic
1055483486 9:76733496-76733518 GAGGACCACTGGGGCCCAGAGGG - Intronic
1057204062 9:93160179-93160201 GAGGTGACCAGGGGCCCAGAGGG + Intergenic
1057250028 9:93493723-93493745 GAGGACACTGGGCCCCCAGGAGG - Intronic
1057461941 9:95271054-95271076 AAGGACAGTCGTGCCCCAGAGGG + Intronic
1060010582 9:120040001-120040023 GGAGAGACCCGGGCTCCAGATGG + Intergenic
1060886783 9:127160276-127160298 CAGGACACCCGGCCCCAAGGAGG - Intronic
1060901415 9:127261318-127261340 GAGGACTCTGGGGCCCAAGAGGG - Intronic
1061415232 9:130443999-130444021 GAGGACTCCCGGTCCTCAGCCGG - Intergenic
1061904579 9:133690135-133690157 GAGGACCCCAGGATCCCAGAGGG - Intronic
1061917608 9:133763400-133763422 GGGCACACCCGGACCCCACACGG - Exonic
1062047258 9:134430239-134430261 GCTGACATCCGGTCCCCAGAAGG - Intronic
1062157357 9:135060521-135060543 GAGGACACCCAGGCTTCAGTTGG - Intergenic
1202792187 9_KI270719v1_random:95324-95346 GAGGGCACTCAGACCCCAGATGG - Intergenic
1202792350 9_KI270719v1_random:96148-96170 GTGGACACCCAGGACCCAGATGG - Intergenic
1202793110 9_KI270719v1_random:100051-100073 GAGGACACCCAAGTGCCAGAAGG - Intergenic
1202793834 9_KI270719v1_random:103652-103674 GTGGACACCCAGTCCCCAGGTGG + Intergenic
1203632132 Un_KI270750v1:80209-80231 GTGGACACCCAGGCCCCATATGG + Intergenic
1203632255 Un_KI270750v1:80791-80813 GTGGACACCCAGGCCCCAGGTGG + Intergenic
1203632337 Un_KI270750v1:81183-81205 GTTGACACCCAGGGCCCAGATGG + Intergenic
1185728753 X:2444465-2444487 GAGGAGACCTGGGCGGCAGACGG + Intronic
1186092516 X:6065063-6065085 GAGGACGCACGGGCCCAAAAAGG + Intronic
1189529586 X:41865916-41865938 AAGGAGACCCAGGCCCCAGTAGG - Intronic
1190237963 X:48631946-48631968 GAGGCCACCCGGAGGCCAGAAGG - Intergenic
1192027214 X:67466417-67466439 GAGGTCTCCCAGGCCCCAGGTGG - Intergenic
1192318571 X:70069818-70069840 CAGGTCACCCTGTCCCCAGAGGG - Intergenic
1195599210 X:106726923-106726945 CAGGAGACCCCGGCCCCAGGCGG - Exonic
1196820104 X:119694490-119694512 GAGGAAACCCGGGCCCAAGAGGG + Intergenic
1197623467 X:128778627-128778649 GAGCTCCCCCGGGCCCCAGGTGG + Intergenic
1199634819 X:149805250-149805272 GAGGACGCCCCCGCCCCAGAGGG + Intergenic
1201149471 Y:11087779-11087801 GTGGACACCCAGTCCCCAGGTGG - Intergenic
1201150183 Y:11091416-11091438 GAGGACACTCAAGCGCCAGAAGG + Intergenic