ID: 1029696500

View in Genome Browser
Species Human (GRCh38)
Location 7:102217153-102217175
Sequence GACACAGATGGCCCTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029696500_1029696504 2 Left 1029696500 7:102217153-102217175 CCTGAAGCAGGGCCATCTGTGTC 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1029696504 7:102217178-102217200 CCAGTGTCCCTTCAGCAATCTGG 0: 1
1: 0
2: 4
3: 16
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029696500 Original CRISPR GACACAGATGGCCCTGCTTC AGG (reversed) Intronic
900854531 1:5170446-5170468 GACAGAGATGGCCCCTCTGCTGG - Intergenic
901521322 1:9787177-9787199 GAAACAGAAGCCCCTTCTTCTGG - Intronic
904263345 1:29303802-29303824 GACACACATGCCCCAGCCTCGGG - Intronic
904291410 1:29488414-29488436 GACACACATGCCCCAGCTTGGGG + Intergenic
904432073 1:30470752-30470774 GACAGAGATAAACCTGCTTCAGG + Intergenic
904754029 1:32758297-32758319 CACACACATGGCCCTCCTTCTGG + Intronic
905973056 1:42155484-42155506 GCCACAGAGGGCCCAGGTTCAGG + Intronic
907400856 1:54223932-54223954 AACACAAATGGCCCTGGTGCAGG - Intronic
907916986 1:58880206-58880228 GACACAGAAGAAACTGCTTCGGG - Intergenic
908748666 1:67399324-67399346 GGCACAGATGGGCTGGCTTCTGG - Intergenic
909344526 1:74570826-74570848 GACACAGATCTCACTACTTCAGG + Intronic
910985162 1:92998186-92998208 CAAAGAGATAGCCCTGCTTCTGG + Intergenic
912198236 1:107425024-107425046 GGCCCAGAAGCCCCTGCTTCAGG + Intronic
913286322 1:117229965-117229987 GACACTGATGGCTCTACCTCAGG - Intergenic
916588870 1:166171001-166171023 GTCAGAGATCACCCTGCTTCTGG - Intergenic
919352749 1:196479775-196479797 GGTACAGATGGTCATGCTTCTGG - Intronic
920254094 1:204642595-204642617 CACACAGCTGGCTCTGCCTCAGG + Intronic
921065386 1:211618980-211619002 GACACAGATGCCTCTGTGTCTGG - Intergenic
923787724 1:237084239-237084261 GACACAGATGGATTTGCTTTGGG - Intronic
924286904 1:242496811-242496833 GACACATATAATCCTGCTTCTGG - Intronic
1063549512 10:7016795-7016817 GACACAGATGGGACTTCTTTGGG - Intergenic
1064639701 10:17403135-17403157 GAAACAGATGGACCTGGCTCAGG + Intronic
1065828204 10:29590929-29590951 AACAAAGATGTCCTTGCTTCAGG - Intronic
1069592158 10:69648820-69648842 GAAACAGCTGGCCCTGGTCCTGG - Intergenic
1069984835 10:72275893-72275915 GACCCAGATGGCACTCCTCCCGG - Exonic
1071960378 10:90804151-90804173 GACATAGATGGCTGGGCTTCAGG + Intronic
1074255865 10:111802018-111802040 CACACAGATTGCCTTACTTCTGG - Intergenic
1076300408 10:129421463-129421485 GACACAGAGGGGCCTGGTTCAGG - Intergenic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1076688887 10:132210800-132210822 GACACGGAGGGCACTGCCTCGGG - Intronic
1077116708 11:888459-888481 GAGACAGATGGCTCTGCTGCCGG - Intronic
1077486766 11:2842325-2842347 GAGACAGATGGCACTGAGTCTGG - Intronic
1079036402 11:17024145-17024167 GACAGGGATGGCTCTGCTTAAGG - Intergenic
1079425785 11:20341238-20341260 GACTTAGATGGCCCTTCTTGAGG - Intergenic
1079452450 11:20609046-20609068 GACACAGAAGCCCCTGTCTCTGG + Intronic
1080089021 11:28321887-28321909 TATACAGATGGATCTGCTTCTGG - Intronic
1081906306 11:46672586-46672608 CACACAGATGGCCCTGCTGAGGG - Exonic
1083865946 11:65453031-65453053 GAGACAAAGGGCCCTACTTCCGG - Intergenic
1083952725 11:65965808-65965830 GACACTGGTGGCCTTGCTACCGG + Intronic
1086153386 11:83638678-83638700 GCCACAGATGGCCATACTTTGGG + Intronic
1088755680 11:112883305-112883327 GAGACAGCTGGCCGTGCTTGGGG + Intergenic
1089609508 11:119661544-119661566 GACACGGATGTCCCCTCTTCTGG - Exonic
1089771635 11:120807350-120807372 GACAGGGAAGCCCCTGCTTCTGG - Intronic
1093389045 12:18595663-18595685 GATACAGCTGGCCCTGCCTAAGG - Intronic
1097174557 12:57135354-57135376 GACACAGAAGGCTCTGCTGAGGG + Intronic
1098664602 12:73146513-73146535 GACACAGATACCCGTGCTTGGGG - Intergenic
1100617514 12:96242548-96242570 AACATACATGGCGCTGCTTCTGG + Intronic
1102486300 12:113259888-113259910 GCAACAGATGGCCCTGCACCAGG + Intronic
1103452464 12:121038956-121038978 GACAGAGATGGCACTGATGCAGG - Exonic
1104270624 12:127279676-127279698 GACACAGCTGACTTTGCTTCAGG - Intergenic
1106900684 13:34351935-34351957 GACAGAGATGCCTTTGCTTCAGG - Intergenic
1108589756 13:51902636-51902658 GAGGCAGGTGGCCTTGCTTCTGG - Intergenic
1109200618 13:59426840-59426862 GACAGAGATGGCCAAGCCTCTGG + Intergenic
1109243268 13:59918557-59918579 CCCACAGCTGGCCCTGCATCAGG - Intronic
1110413073 13:75224235-75224257 GACCCAGCTGGCCCTACTCCTGG - Intergenic
1111095534 13:83509749-83509771 CAAACAAATGGTCCTGCTTCTGG + Intergenic
1112328815 13:98461874-98461896 GAAACAGATGGCCAAGCCTCGGG - Exonic
1113372186 13:109733928-109733950 AGCACGGATGGCGCTGCTTCCGG - Intergenic
1114324419 14:21574529-21574551 TAGACAGATGGTCCTGCTGCTGG + Intergenic
1118395066 14:65329209-65329231 GACCTAGAAGCCCCTGCTTCTGG - Intergenic
1118472515 14:66088018-66088040 GACAAAGATGTCCCTGCTAAAGG + Intergenic
1120585838 14:86311462-86311484 CACACAGATGGCCCTGAAACCGG + Intergenic
1123043371 14:105499627-105499649 GACACAGATGGCTCTTTGTCAGG - Intergenic
1124393587 15:29281522-29281544 GAGACAGTTGCCCCTGCTTGAGG - Intronic
1124449197 15:29770064-29770086 GACACTGATGACCCTGATCCTGG + Intronic
1129255472 15:74331611-74331633 GCCCCAGGTGGCCCTTCTTCAGG - Intronic
1132342060 15:101085124-101085146 GACACTGGAGGCCCAGCTTCCGG - Intergenic
1132621957 16:871994-872016 GACTCAGAGGGACCCGCTTCTGG + Intronic
1133261972 16:4556765-4556787 GAACCAGCTGGCCCTGCTGCAGG + Exonic
1133750208 16:8719387-8719409 GACACAGATAGCCTTTGTTCTGG - Intronic
1135587323 16:23680807-23680829 GGATCAGATGGCCCTGGTTCTGG + Intronic
1136775090 16:32867642-32867664 GCCACTGGTGGCCCTGCTACTGG + Intergenic
1136895528 16:33993870-33993892 GCCACTGGTGGCCCTGCTACTGG - Intergenic
1138312617 16:56040827-56040849 GACAAAGATGGCCATGGTCCTGG - Intergenic
1138350570 16:56344324-56344346 GGCGCAGATGGCCCTGCAGCAGG + Exonic
1138580082 16:57935185-57935207 GAGACGGATGGGCCTGCTGCAGG - Intronic
1203077508 16_KI270728v1_random:1129751-1129773 GCCACTGGTGGCCCTGCTACTGG + Intergenic
1142595662 17:1028690-1028712 GACCCACATGGCTGTGCTTCAGG + Intronic
1143013120 17:3877165-3877187 GGCAAAGATGTCCCTGCTGCTGG + Intronic
1144627049 17:16849352-16849374 GACCCAGCTGGCCCAGCTGCAGG - Intergenic
1144855378 17:18264533-18264555 GACCCAGGTGGTCCTGCGTCTGG + Exonic
1144879392 17:18423360-18423382 GACCCAGCTGGCCCAGCTGCAGG + Intergenic
1145152848 17:20521027-20521049 GACCCAGCTGGCCCAGCTGCAGG - Intergenic
1147845533 17:43401757-43401779 GACATAGCTGGCCCTGGTGCTGG - Intergenic
1147869769 17:43579037-43579059 GAGAGAGGTGGCCCGGCTTCAGG - Intronic
1148326831 17:46788176-46788198 GAAACAGATGGCCAAGCTCCAGG - Intronic
1149840787 17:59963252-59963274 GACCCAGATGTCTTTGCTTCAGG + Exonic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1151406419 17:73890040-73890062 GACACAGGTAGCTCTGCTACTGG - Intergenic
1151889170 17:76942058-76942080 GGCGCTGATGGCCCTGCTGCAGG + Intronic
1152339692 17:79717120-79717142 TACACAGATGGCCCTGCCTTAGG + Intergenic
1152734911 17:81992573-81992595 GACACAGATGGCCAGGGGTCCGG - Intronic
1153723832 18:7936064-7936086 GACAGAGATGGCCATGGTTGGGG + Intronic
1156885911 18:42135687-42135709 GACAAAGATGCCCCTGCTGTAGG - Intergenic
1157913718 18:51643675-51643697 GAGACAGATGGCCCTGATTTGGG + Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160006132 18:75070342-75070364 GACAGAGGTGGCCCTGCTCTGGG - Intergenic
1163646711 19:18493683-18493705 GGCTCAGTTGGCCCTGCCTCAGG + Intronic
1164085944 19:21902555-21902577 GACTCACATCGCCTTGCTTCTGG - Intergenic
1164536224 19:29088146-29088168 GACACAGATGCCCCAGCCACGGG + Intergenic
1164783310 19:30910636-30910658 GACGCAGCAGGCCCTGCTCCAGG - Intergenic
1164803759 19:31099989-31100011 GAAACAGATGTTCCTGCTCCAGG + Intergenic
1164915442 19:32048110-32048132 GACATCGAGGGCCCTGCCTCTGG + Intergenic
1166597592 19:44063627-44063649 GCCACAAATGGCCTGGCTTCAGG - Intronic
1167408109 19:49327510-49327532 CACACAGTTTGCCCTGCCTCAGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
927486423 2:23491449-23491471 GCCACACAGGGCCCTGCTACTGG - Intronic
932276432 2:70455289-70455311 GAAACACATGGCCCTGGTTCTGG - Intronic
933165738 2:79072602-79072624 CTCACAGATGGTCCTGCTCCAGG - Intergenic
933593535 2:84259979-84260001 GGCACAGACGGCTCTGCTTGTGG - Intergenic
934516162 2:94988101-94988123 GACACAGACGGCCAGGCTGCTGG + Intergenic
937991172 2:127663376-127663398 TCCACAGATGGCCGTGCTGCCGG + Intronic
941763900 2:169275132-169275154 GACAAAGATGGCCGTGCTGAAGG - Exonic
942404017 2:175633951-175633973 GAGACAGATGGCACTGGTTAAGG - Intergenic
945420833 2:209634036-209634058 AGCAAAGATGGCCCAGCTTCTGG - Intronic
945781731 2:214183221-214183243 GACAGAAATGGATCTGCTTCAGG - Intronic
947820189 2:233063849-233063871 GGCAGAGTTGGCCCTGCTCCGGG + Intronic
947870415 2:233434025-233434047 GACACAGTTGCTACTGCTTCAGG - Intronic
948432798 2:237930743-237930765 GGCACACATGGCCCAGCTACGGG + Intergenic
1169781985 20:9319623-9319645 GATACTGATGCCCCTGGTTCTGG - Intronic
1170300751 20:14881772-14881794 GACTTAGAGGGCCCTGGTTCTGG - Intronic
1170771632 20:19337972-19337994 CACAAAGATGGCCCATCTTCAGG + Intronic
1171097228 20:22343656-22343678 GACACGGTTGGGCCTGTTTCGGG + Intergenic
1173836402 20:46128832-46128854 GGCACAGCTGCCCCTGCTGCTGG + Intronic
1173901636 20:46594576-46594598 AGCAAAGATGGTCCTGCTTCAGG - Intronic
1174420133 20:50394071-50394093 TCCTCAGATGGCCCTGCCTCAGG - Intergenic
1175463441 20:59172498-59172520 GACCCAGAAGGCCCCTCTTCAGG - Intergenic
1175736879 20:61393292-61393314 GAAACAGAAGGCCCAGCATCCGG + Intronic
1176238347 20:64064534-64064556 CACACAGCTGGCCCTGCCCCAGG - Intronic
1177791475 21:25726698-25726720 GACCCAGTTGGCCCTGCTGCTGG - Intronic
1177931295 21:27287278-27287300 TACACACTTGGCCCTGCTTCTGG - Intergenic
1179393072 21:41011334-41011356 GACACAGGCAGTCCTGCTTCCGG + Intergenic
1182119737 22:27779037-27779059 GACCCAGATGGGGCTGGTTCGGG - Intronic
1183795188 22:40111491-40111513 GCCACTGACTGCCCTGCTTCTGG - Intronic
1185102028 22:48845725-48845747 GACACAGAGGCCCCAGCGTCGGG + Intronic
1185345417 22:50308494-50308516 GACAGAGCTGGCCCCACTTCTGG + Intergenic
950577252 3:13839572-13839594 GTCACAGATGGACCAGCTCCTGG - Intronic
951991241 3:28678049-28678071 GCCAGAGATGGCCAGGCTTCAGG - Intergenic
952080499 3:29752188-29752210 GCCACAGATGGCCCAACTCCAGG - Intronic
952849826 3:37718796-37718818 CACACAGAGGGGCCTGCATCTGG + Intronic
952855235 3:37764761-37764783 TTCACAGATGGCCCTGCCTCAGG + Intronic
953406318 3:42661666-42661688 GATAGAGATGGACCAGCTTCTGG + Intronic
954995941 3:54881812-54881834 GCCATGGATGGCCCAGCTTCTGG - Intronic
957275742 3:78089317-78089339 TACACAATTGGCCCTGCTTTTGG - Intergenic
960959424 3:123058997-123059019 GACAAAGATGGCACGGCATCTGG - Intergenic
961191717 3:124967966-124967988 CACACAGATGCCCCTGCGCCCGG + Exonic
962061147 3:131929068-131929090 GAGAGAAATGTCCCTGCTTCTGG + Intronic
963592434 3:147278948-147278970 GACACAGATGTCCCTATTTGGGG - Intergenic
967269070 3:187718093-187718115 TTCACAGATAGCCATGCTTCTGG - Intronic
967269078 3:187718145-187718167 CACACAGATAGCCATGCTTCTGG - Intronic
969487442 4:7480187-7480209 CACAGACATGTCCCTGCTTCAGG - Intronic
969505582 4:7585217-7585239 GGCCCCGATGGACCTGCTTCAGG - Intronic
969562779 4:7960096-7960118 GACCCAGCTGGCCTTCCTTCGGG + Intergenic
972341576 4:38156608-38156630 GGCACAGACGATCCTGCTTCAGG + Intergenic
985844434 5:2333988-2334010 GACACAGGCGTCCCTGCTACTGG - Intergenic
986711812 5:10493202-10493224 GGCACAGATGGCCCATCTTCAGG - Intergenic
987101865 5:14598057-14598079 AAGAGAGATGGCCCAGCTTCAGG + Intronic
992323211 5:75634780-75634802 GTCCAAGATGGCCCTTCTTCAGG - Intronic
992396491 5:76373657-76373679 GACATACAAGGCCCTGCTCCCGG - Intergenic
993095287 5:83472964-83472986 GACCCAGAGGCCCCTGATTCGGG - Intronic
994789340 5:104204481-104204503 GGAACAAATGGGCCTGCTTCTGG + Intergenic
998015876 5:138731859-138731881 GTCACAGATGGCCCAACTTGAGG + Intronic
998848780 5:146335444-146335466 GATACAGAAGACACTGCTTCAGG - Intronic
999644704 5:153706246-153706268 GACAGAGATGGCCCAGCTACAGG - Intronic
999712731 5:154332708-154332730 GATGAAGATGGCCCTGCTGCTGG - Intronic
1002342256 5:178524736-178524758 AAAAAAGAAGGCCCTGCTTCAGG - Intronic
1003816187 6:9843309-9843331 GTCACAGATGGCCCTACTGATGG - Intronic
1005226498 6:23649624-23649646 GATACAGAAGGACCAGCTTCTGG - Intergenic
1006401644 6:33821227-33821249 GACACAGATGCCCCTGCAACTGG - Intergenic
1007655503 6:43448986-43449008 CACTCAGGTGGCACTGCTTCAGG - Exonic
1007721949 6:43890466-43890488 GACACAGGGGCCCCGGCTTCAGG + Intergenic
1013597940 6:111677598-111677620 CCCACAGATGTCCCTGCTGCAGG + Intronic
1014370595 6:120602586-120602608 CACACAGAGGGCCTTGCTCCCGG - Intergenic
1015178304 6:130335398-130335420 GACACAGGTGGCCCTCTATCAGG - Intronic
1018066787 6:160130334-160130356 GACACAGTGGCCCCTGCTTTGGG + Intronic
1018094031 6:160368935-160368957 GACACAACTGGCCATGCTTCAGG + Intronic
1018860472 6:167707571-167707593 GACACAGGTGGCCTGGCATCAGG + Intergenic
1019290244 7:246747-246769 GACACAGAGGGCCCTGCTCAGGG - Intronic
1022233951 7:28443475-28443497 GGTACAGATGGCCTTGGTTCTGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023135638 7:37049191-37049213 GACACAGCTGGCACTGAGTCGGG + Intronic
1024261410 7:47576655-47576677 GACGCAGATGCCCCTGCTAATGG + Intronic
1029323292 7:99784246-99784268 AGCACAGGTGGCCCTGCTACTGG - Exonic
1029696500 7:102217153-102217175 GACACAGATGGCCCTGCTTCAGG - Intronic
1031308622 7:120165137-120165159 AACAAAGATGGCCTTTCTTCTGG + Intergenic
1034115464 7:148579854-148579876 GGAACAAATGGCCCTGCTACTGG - Intergenic
1037409404 8:18580248-18580270 GCCAGAGATGGACCTGCTCCGGG + Intronic
1041168075 8:55111200-55111222 GACACATACGGCCCAGCTCCTGG + Intronic
1041404087 8:57478312-57478334 GACACAAGTGGCCTTGCTTGTGG - Intergenic
1042089767 8:65145984-65146006 CACACAGGTGGTCCTGCTCCTGG - Intergenic
1048483977 8:134831199-134831221 GACACACATCACCTTGCTTCGGG + Intergenic
1049397099 8:142405974-142405996 GTCACAGCTGGCCCAGCTGCTGG - Intergenic
1049657624 8:143805710-143805732 GCCACACATGGCCCCGCTCCTGG + Intronic
1053016313 9:34664329-34664351 GAAAGAGATGGCCCAGTTTCTGG - Exonic
1057016427 9:91656697-91656719 GGAATAGCTGGCCCTGCTTCTGG - Intronic
1057938123 9:99257727-99257749 GACCCAGATCCCCCAGCTTCAGG - Intergenic
1060433191 9:123568678-123568700 GATACAGATTTCCCTGCTTAGGG + Intronic
1062020043 9:134315066-134315088 TTCACAGAAGGCCCTGCTACTGG + Intergenic
1188422363 X:30005555-30005577 GTGTCAAATGGCCCTGCTTCAGG - Intergenic
1192047109 X:67687266-67687288 TCCACACATGGCCCTGCTCCAGG - Intronic
1195590660 X:106621822-106621844 GACAGACATGGCCCTGTATCAGG - Intronic
1200104845 X:153706418-153706440 GCCACTGGTGGCCCTGCTGCTGG - Intronic
1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG + Intronic
1200893622 Y:8350614-8350636 GACACCTATGTCCATGCTTCTGG - Intergenic