ID: 1029697682

View in Genome Browser
Species Human (GRCh38)
Location 7:102224964-102224986
Sequence TGCCAGGCCGGCCCCTCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029697678_1029697682 11 Left 1029697678 7:102224930-102224952 CCTTGACAGTATCTGGTGAGCAA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1029697682 7:102224964-102224986 TGCCAGGCCGGCCCCTCGCATGG 0: 1
1: 0
2: 1
3: 13
4: 139
1029697677_1029697682 15 Left 1029697677 7:102224926-102224948 CCATCCTTGACAGTATCTGGTGA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1029697682 7:102224964-102224986 TGCCAGGCCGGCCCCTCGCATGG 0: 1
1: 0
2: 1
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029697682 Original CRISPR TGCCAGGCCGGCCCCTCGCA TGG Intronic
900712124 1:4121064-4121086 TGGCAGGAGGGCCCCTGGCAAGG + Intergenic
901123706 1:6914635-6914657 TCCCAGGCAGGCCCCTAGGAAGG + Intronic
901446089 1:9308962-9308984 TGCCCGCCCAGCCCCTGGCAGGG - Intronic
903322141 1:22549739-22549761 TGGCAGGCCGCCCCCTTGGAAGG - Intergenic
904370343 1:30044125-30044147 GGCCAGGCAGGACCCTGGCAGGG - Intergenic
905629281 1:39509995-39510017 TGGCAGGCCAGCCCCTGCCACGG + Intronic
905668477 1:39776198-39776220 TGGCAGGCCAGCCCCTGCCACGG - Intronic
913317062 1:117562578-117562600 TCTCAGGACAGCCCCTCGCAGGG + Intergenic
916535395 1:165698687-165698709 GGCCAGGCCCTCCCCTCGCCAGG + Exonic
920100781 1:203515774-203515796 TCCCAGGCCTGTCCCTGGCAGGG - Intergenic
924070417 1:240272395-240272417 TGCCAATCCGACCCCTCTCAAGG - Intronic
1066649409 10:37640440-37640462 TGCCTGGCCGCCCCCTCCCTGGG - Intergenic
1070392548 10:75984009-75984031 TGCCTGGCCGGCTCCCTGCATGG - Intronic
1072303598 10:94085743-94085765 TGCCAGAACGGCCACTAGCAGGG + Intronic
1076997280 11:304270-304292 TGCGGGGCCCGCCCCGCGCAAGG + Intergenic
1077254643 11:1574702-1574724 CGCCTCCCCGGCCCCTCGCAAGG - Intergenic
1077352890 11:2100974-2100996 TCCCGGGCAGGCCCCTGGCACGG + Intergenic
1077551511 11:3202528-3202550 TGCCAGGCCGACACCCCTCAAGG - Intergenic
1078315384 11:10289597-10289619 TGCCAGGCCTGACACTCCCAAGG - Intronic
1078638304 11:13073122-13073144 TGCCAGTGCGGCACCTAGCATGG + Intergenic
1081669069 11:44933309-44933331 TGCCAGGTGGGCCCCTGCCAGGG - Exonic
1083764997 11:64837429-64837451 TCTCAGGCCAGCCCCTCGAATGG + Intronic
1083861507 11:65422631-65422653 TCCCAGGCGGCCCCCACGCAAGG - Intergenic
1083898578 11:65632707-65632729 TGCCAGGCCAGCTCCTCTCCCGG + Intronic
1084315498 11:68343128-68343150 TGCCAGGCCTGCACCTCACCAGG - Intronic
1084531518 11:69730577-69730599 AGCCAGGCCAGCCCCTCCCTGGG - Intergenic
1086821350 11:91439910-91439932 TGCCAGGTTGGCCCCTGGCAAGG - Intergenic
1089586844 11:119515065-119515087 TGCCAGCCCAGCCCCAAGCATGG + Intergenic
1090385489 11:126355704-126355726 TCCCAGGCCGGACCCGCGCCCGG + Intronic
1091090682 11:132768764-132768786 TGCCAGCCAGGCCCCCAGCAAGG + Intronic
1092876835 12:12856048-12856070 TGCCAGGCTGTCCCATAGCATGG + Intergenic
1095098548 12:38160380-38160402 TGGCGGGCCGGGCCCTCCCACGG + Intergenic
1097186619 12:57199654-57199676 AGGCAGGCCGGCCCCTGGGAGGG + Intronic
1102796990 12:115697394-115697416 TGCCAGGATGGCCCCTCCAAAGG + Intergenic
1106177820 13:27346488-27346510 TGCCAGGCCCCCGCCTGGCATGG + Intergenic
1109127180 13:58531882-58531904 TGGCAGGCCTGTCCCTCCCAGGG - Intergenic
1113506062 13:110816720-110816742 TGCCAGCCAGGCCACTGGCAGGG - Intergenic
1122427723 14:101621330-101621352 TGGCAGGCCGGCCACTCGGCTGG + Intergenic
1122968648 14:105143608-105143630 TGTCAGGCAGGTCCCTGGCAGGG + Exonic
1123113358 14:105883031-105883053 GACCAGGCCAGCCCCTAGCAGGG + Intergenic
1123402693 15:20003459-20003481 GACCAGGCCAGCCCCTAGCAGGG + Intergenic
1123512032 15:21010113-21010135 GACCAGGCCAGCCCCTAGCAGGG + Intergenic
1123993519 15:25702225-25702247 TGGCAGCCCAGCCCCTGGCAAGG - Intronic
1126767063 15:52019635-52019657 CGCCTGGCCGGCCCCACGCGGGG - Intronic
1128241643 15:66105345-66105367 TGCAAGGCCGGGCCCTGCCATGG + Intronic
1128786242 15:70399645-70399667 TGCCAGGACTGCCCCTCTCCTGG + Intergenic
1129228305 15:74182459-74182481 TGCCACTCCCGCCCCTGGCAGGG - Exonic
1132556184 16:573754-573776 TTCCAGGCCGGCCCAGGGCACGG - Intronic
1132561397 16:596119-596141 TGCCAGCCAGGTCTCTCGCAGGG + Intronic
1132703121 16:1230348-1230370 TGCCAGGCAGGCCCCGCTGAGGG + Intergenic
1132705200 16:1240520-1240542 TGCCAGGCAGGCCCCGCTGAGGG - Intergenic
1132708330 16:1255883-1255905 TGCCAGGCAGGCCCCGCCGAGGG - Intergenic
1133171484 16:3984972-3984994 TGCCAGGCTGGACCCTGCCAGGG + Intronic
1134444361 16:14319717-14319739 AGCCAGGCCTGCCCCTCTCAGGG - Intergenic
1136156873 16:28388915-28388937 TGCCAGGCCTGGCCCTTGCCTGG + Intronic
1136206213 16:28726366-28726388 TGCCAGGCCTGGCCCTTGCCTGG - Intronic
1136535614 16:30897257-30897279 AGCCAGGCCAGCGCCTTGCATGG + Intronic
1137056353 16:35748262-35748284 TGCCAGGACGGACCCCCGCGCGG - Intergenic
1139923408 16:70473196-70473218 TGCCACGCTGGCCTCTCGCCGGG + Exonic
1141948685 16:87326905-87326927 TCCCAGGCCGACAGCTCGCATGG + Intronic
1142147023 16:88496984-88497006 TGCCAGGCCTGCCCCTGCCCAGG + Intronic
1142182759 16:88679216-88679238 GGCCAGGCCAGCCTCCCGCAGGG + Intronic
1142415177 16:89937219-89937241 TGCCTGGCCGACCCCTCGCATGG + Intergenic
1142598942 17:1043776-1043798 TGCCAGGGCAGCCCCTCCCTGGG - Intronic
1143118244 17:4592520-4592542 TGCCAGGCTGGCCCTTGGCCTGG + Intronic
1143285840 17:5788723-5788745 TGCCAGGCAGGCCCCATGCTGGG - Intronic
1143908591 17:10229008-10229030 TGCCATGCCAGTGCCTCGCAAGG - Intergenic
1144783661 17:17820175-17820197 TGGCAGGAGGGCCCCTGGCAGGG + Exonic
1149685482 17:58532180-58532202 TGCGAGGCCGGCCCCCAGCTGGG - Intronic
1151682444 17:75629181-75629203 TGCTAGCCCGGCCCTTGGCAAGG + Exonic
1151956234 17:77381483-77381505 GGCCTGGCCTGCCCCTCGCAGGG - Intronic
1152196415 17:78921053-78921075 CGCCACGCCGCCCCCTCGCATGG + Intronic
1152521623 17:80859902-80859924 TGGGGTGCCGGCCCCTCGCATGG - Intronic
1152637904 17:81437702-81437724 TGCCAGACAGGCCCCTCTCTTGG - Intronic
1154197821 18:12279260-12279282 GGCCAGGCCGGCCACACGCCTGG - Intergenic
1154344650 18:13531897-13531919 GGCCAGGCCGCCCCCCAGCAGGG - Intronic
1155007373 18:21741119-21741141 TGCCACCCCGGCCCCTCGCTCGG - Intronic
1156451612 18:37269604-37269626 TGCCAGGCAGGTCCCTCCAAAGG + Intronic
1157390103 18:47294610-47294632 TGCCAGCCCTGCCTCTCTCAAGG - Intergenic
1160700077 19:501887-501909 TCCCAGGCTGGGCCCACGCAGGG + Exonic
1160754763 19:751465-751487 TGCCAACCCGGCCCCTCCCTTGG - Intronic
1160897539 19:1409710-1409732 TGCCAGGAGGGCGCTTCGCAGGG - Intronic
1160990154 19:1857126-1857148 TGCCAGCCCCGCCCCGCGCTTGG + Intronic
1162968357 19:14166264-14166286 TGGCAGGCTGCCCCCTCCCAGGG + Intronic
1165419973 19:35717859-35717881 GGCCGGGCCGGCCACGCGCAGGG - Intergenic
1165728733 19:38130618-38130640 TGGCAGGCCGGCCTCCGGCAGGG + Exonic
926224929 2:10960908-10960930 AGCCACGCCGGCCCCTCCCCGGG - Intergenic
927210876 2:20638317-20638339 TCCCAGGTCGCCCCCTCGCAGGG - Intronic
927684556 2:25161482-25161504 TGCCAAGCCGGGCCCGCGCGAGG - Exonic
928394091 2:30930971-30930993 TTCCAGGCCGGCCCCCCTCCAGG + Intronic
929572858 2:43033631-43033653 TACCAGCCCGGCCCCTGCCAGGG + Intergenic
932254549 2:70273085-70273107 TGCCACCCCGCCCCCTCCCAGGG + Intronic
933723112 2:85410542-85410564 TGCCAGGCCGTCTCCTCAGAGGG + Exonic
946386729 2:219388130-219388152 CGCCCGCCCTGCCCCTCGCAGGG + Intronic
946445979 2:219740218-219740240 TGCCAGCCCCGCCCCTGGCATGG - Intergenic
947723139 2:232381246-232381268 TGCAGGGCTGGCCCCTGGCAAGG + Exonic
947727489 2:232409327-232409349 TGCAGGGCTGGCCCCTGGCAAGG + Exonic
947885584 2:233566823-233566845 TGGAGCGCCGGCCCCTCGCACGG + Intergenic
947983514 2:234429347-234429369 GGCCAAGCCGGCCCATCGAAGGG - Intergenic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1169343041 20:4810614-4810636 TGCCAGGGCTGCCCCTCCCTTGG - Intronic
1173824009 20:46035767-46035789 TCCCTGGCAGGCCCCACGCATGG + Exonic
1174173696 20:48632181-48632203 TGCCAGGCGGACCCCCAGCATGG - Intronic
1174483825 20:50849098-50849120 TGCCAGGCCGGCCCTCCTCCTGG + Intronic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1179155549 21:38847908-38847930 TGACAGGCAGGACCCTGGCAGGG + Intergenic
1179243818 21:39613046-39613068 TGCCGGGGCTGCCCCGCGCACGG + Intronic
1179639078 21:42735353-42735375 TGCAAGGCAGGCCCCACGAAGGG + Intronic
1180993855 22:19954788-19954810 TAGCAGGTAGGCCCCTCGCAGGG + Intronic
1181035683 22:20168761-20168783 AGCCAGGCCAACCCCACGCAGGG - Intergenic
1181147522 22:20859167-20859189 CGCCCGGCCGGCCCCTTGGAGGG + Exonic
1183439708 22:37816278-37816300 TGCCCGGCTGGCCTCTCGCATGG + Exonic
1183605852 22:38866421-38866443 TGCCGGCCCGGCACCTCCCACGG - Exonic
949954172 3:9253830-9253852 TGCCATTCCGTCCCCTCCCAGGG - Intronic
950422319 3:12906377-12906399 TGCCAGCCCTGCCCCTCCCCAGG + Intronic
950683679 3:14602271-14602293 AGCCCGGGCGGCCCCGCGCAGGG + Intergenic
954647531 3:52140663-52140685 TGCCAGGCCAGCCCCTCTTCTGG - Intronic
959631552 3:108512868-108512890 TGCCAGGCCCGCCCCACTCCTGG - Intronic
961459526 3:127041515-127041537 TGGCAGGCCTGTCCCTCGCTGGG + Intergenic
961596486 3:128022090-128022112 TGCCAGGCCGTCCACTCACTTGG - Intergenic
969167498 4:5329599-5329621 TGTCAGCCCAGCCCCTCCCAGGG + Intronic
969579416 4:8055420-8055442 TGCAGTGCCAGCCCCTCGCAGGG - Intronic
970261164 4:14226699-14226721 TGAAAGGCCTGCCCCTCCCAGGG + Intergenic
976883734 4:89961533-89961555 TGCCAGATGGGCTCCTCGCAAGG + Intergenic
985068508 4:186145232-186145254 CGTCAGGCCGGCCCCGGGCATGG + Intronic
986631905 5:9782171-9782193 TGCCAGGCCTGCCCTGTGCATGG - Intergenic
992297328 5:75337783-75337805 TGTCGGGCCGGCAGCTCGCAGGG + Intronic
998037059 5:138926340-138926362 TGCCAGGACTGCACCTTGCAAGG - Intronic
999430481 5:151521395-151521417 TGGCAGGTTGGCCCCTGGCAGGG + Exonic
1001319322 5:170667411-170667433 TGGCAGGCAGGCCCCTGGGAGGG + Intronic
1002199738 5:177521014-177521036 TGCCAGGCCAGCTCCTCTCTGGG - Intronic
1008941152 6:57046955-57046977 TGGCCGCCCGGCCCCCCGCACGG + Intronic
1008945341 6:57090453-57090475 TGGCCGCCCGGCCCCCCGCACGG + Intronic
1016908231 6:149172291-149172313 TCCCAGGCCTGACCCTCACAAGG + Intergenic
1019638673 7:2090666-2090688 GCCCAGGCAGGCCCCCCGCAGGG + Intronic
1026023389 7:66727679-66727701 CTCCAGGCCAGCCCCTCGCAGGG + Intronic
1029697682 7:102224964-102224986 TGCCAGGCCGGCCCCTCGCATGG + Intronic
1032020490 7:128405098-128405120 TGCCAGGCCTGCAGCACGCAGGG + Intronic
1037819694 8:22129737-22129759 TGCCAGGCCTGCACTTCCCACGG - Intronic
1049426289 8:142539441-142539463 TGCCAGCCCGGCCCCCTGCATGG + Intronic
1049604083 8:143521073-143521095 GGCCGGGCCTGCCCCTCCCAGGG - Intronic
1049777732 8:144414189-144414211 TCCCAGGCCGTGCCCTCCCAGGG - Intronic
1049780743 8:144427735-144427757 TGCTAGGCAGGACCCTCCCACGG - Intronic
1053428115 9:38024405-38024427 TTCCAGTCCTGCCCCTCCCACGG + Intronic
1057570974 9:96204069-96204091 GGCCAGGCCCCCTCCTCGCAGGG - Intergenic
1058467591 9:105244766-105244788 TGCCAGGCCGCGCCCTCCCCGGG + Exonic
1058885443 9:109319346-109319368 TGCCCCGCCGACCCCACGCACGG + Intronic
1061593647 9:131614626-131614648 TGCCATGGCGTCCCCTCGCTGGG - Intronic
1061872708 9:133529228-133529250 TGCCAGCCCGGCCTCTGGCAAGG + Intergenic
1062091261 9:134679819-134679841 TGCCAGCCAGTCCCCTCGCGAGG + Intronic
1062184972 9:135213302-135213324 TTCCAGGCCTGCCCCTTGCAGGG + Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1062605925 9:137348835-137348857 GGCCTGGCAGGCCCCTCCCATGG - Intronic
1198749729 X:139926888-139926910 TGCTAGGCTGACCCCACGCAAGG - Intronic