ID: 1029699179

View in Genome Browser
Species Human (GRCh38)
Location 7:102235296-102235318
Sequence GGCTGAACTGCATCCCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029699168_1029699179 20 Left 1029699168 7:102235253-102235275 CCTCAGTCCTCAGGTCACCTATG 0: 1
1: 1
2: 0
3: 25
4: 177
Right 1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG No data
1029699173_1029699179 3 Left 1029699173 7:102235270-102235292 CCTATGGTGCTGGGAGCTCACTG 0: 1
1: 0
2: 0
3: 26
4: 192
Right 1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG No data
1029699165_1029699179 30 Left 1029699165 7:102235243-102235265 CCTCGAGCACCCTCAGTCCTCAG 0: 1
1: 2
2: 9
3: 23
4: 326
Right 1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG No data
1029699167_1029699179 21 Left 1029699167 7:102235252-102235274 CCCTCAGTCCTCAGGTCACCTAT 0: 1
1: 0
2: 3
3: 21
4: 178
Right 1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG No data
1029699170_1029699179 13 Left 1029699170 7:102235260-102235282 CCTCAGGTCACCTATGGTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 150
Right 1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029699179 Original CRISPR GGCTGAACTGCATCCCTTAG GGG Intronic
No off target data available for this crispr