ID: 1029701707

View in Genome Browser
Species Human (GRCh38)
Location 7:102250749-102250771
Sequence TATATGCGTGAGAATAGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029701703_1029701707 -6 Left 1029701703 7:102250732-102250754 CCTCCCTTGTCTATGTGTATATG 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1029701707 7:102250749-102250771 TATATGCGTGAGAATAGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1029701705_1029701707 -10 Left 1029701705 7:102250736-102250758 CCTTGTCTATGTGTATATGCGTG 0: 1
1: 1
2: 2
3: 60
4: 501
Right 1029701707 7:102250749-102250771 TATATGCGTGAGAATAGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1029701704_1029701707 -9 Left 1029701704 7:102250735-102250757 CCCTTGTCTATGTGTATATGCGT 0: 1
1: 0
2: 1
3: 46
4: 408
Right 1029701707 7:102250749-102250771 TATATGCGTGAGAATAGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029701707 Original CRISPR TATATGCGTGAGAATAGAGG CGG Exonic
908825050 1:68125149-68125171 CATATGCGTGACAACAAAGGTGG - Intronic
910872021 1:91842688-91842710 TATATGTGTAGGAAAAGAGGGGG - Intronic
912956432 1:114156877-114156899 TACATGAGGGAGAAAAGAGGAGG + Intergenic
917369468 1:174275039-174275061 TATATGTGTGTGGAGAGAGGAGG - Intronic
923797493 1:237172039-237172061 CATATGTTTGAGAAGAGAGGAGG + Intronic
923908612 1:238414128-238414150 TATATACGTCAGAATAGAATAGG + Intergenic
1063037838 10:2304925-2304947 TAAGTGAGGGAGAATAGAGGTGG + Intergenic
1063686862 10:8245142-8245164 TTTATGCCTGAGAAACGAGGAGG - Intergenic
1072192327 10:93086181-93086203 TAATTGGGGGAGAATAGAGGCGG + Intergenic
1080145880 11:28983467-28983489 TATATGAGAGAGAAAAGTGGGGG + Intergenic
1095157704 12:38878452-38878474 AATATGCATGAGAATTGAGTAGG - Intronic
1095837789 12:46657051-46657073 AATATTTGTGAAAATAGAGGTGG + Intergenic
1096600783 12:52727261-52727283 TATAGGCGTCATAATGGAGGAGG + Intergenic
1098483770 12:70997082-70997104 TATTTGGGTGAGAATAGACATGG - Intergenic
1102416126 12:112764332-112764354 TATAGGAGTGAGAGAAGAGGAGG + Intronic
1110298034 13:73892835-73892857 TATATTTGTGGGAATAGAGGTGG + Intronic
1110328554 13:74245040-74245062 TAGAGGCATGAGAATAGAAGAGG + Intergenic
1112100718 13:96186179-96186201 TATATGCATGAAAACAGACGAGG + Intronic
1112585582 13:100716047-100716069 TTTATGGGTGATCATAGAGGAGG - Intergenic
1112728099 13:102328451-102328473 TTTATGTGGGAAAATAGAGGAGG - Intronic
1115794329 14:36916389-36916411 TATATGCATGAGAAAAAATGAGG - Intronic
1119724505 14:76913945-76913967 TATAAGCCTGAGGACAGAGGCGG + Intergenic
1124203703 15:27699551-27699573 TACATGTGGGAGAAAAGAGGAGG + Intergenic
1125276943 15:38003634-38003656 CATCTGCTTGAGAAAAGAGGAGG - Intergenic
1126342685 15:47660307-47660329 TAAATGTGTATGAATAGAGGAGG + Intronic
1132408586 15:101560209-101560231 TATAAGGGTGAGAAGAGAGAGGG + Intergenic
1137225227 16:46498548-46498570 TATGTGAGTGAGACTAGTGGTGG + Intergenic
1139254299 16:65526580-65526602 TTTATGCGTGGGCACAGAGGTGG + Intergenic
1142292845 16:89200762-89200784 GATCTGCGTGAGAAGAGATGGGG - Intronic
1143407623 17:6688027-6688049 TATATGCGGGAGAGAAGATGTGG - Intronic
1146986489 17:37224917-37224939 ACTATGCTTGAGAATAAAGGAGG + Intronic
1150545378 17:66151759-66151781 CATATGAGTGAGAATAGAAGTGG + Intronic
1153763506 18:8353812-8353834 TAGATGCTTGTGAATAAAGGGGG - Intronic
1155876062 18:31090088-31090110 AATATGAGTGAGAATAGAAATGG + Intronic
1158281942 18:55838107-55838129 TAGATGGATGAGAATATAGGGGG + Intergenic
1158707940 18:59810785-59810807 TGTATGTGTGAGATTGGAGGTGG - Intergenic
1162518409 19:11164402-11164424 GATATGCGTGAGAAGAGAATGGG + Intronic
927403151 2:22737332-22737354 TATATGCATGAGACGATAGGGGG - Intergenic
932806099 2:74784765-74784787 AATAAGGGTGAGAAAAGAGGAGG + Intergenic
938284804 2:130103060-130103082 TAAATGTGTCAGAATAGTGGAGG - Intronic
938430800 2:131235830-131235852 TAAATGTGTCAGAATAGTGGAGG + Intronic
938475615 2:131608949-131608971 TAAATGTGTCAGAATAGTGGAGG + Intergenic
939657121 2:144840364-144840386 TATATAGGTGAGAATAGATGTGG - Intergenic
939940869 2:148349319-148349341 TATATGAGTCAGAATAGTGTTGG + Intronic
942143307 2:173000023-173000045 TATATTCTTGAGAACAGAGTAGG - Intronic
945339153 2:208631080-208631102 TATATTTGAGAGCATAGAGGGGG + Intronic
946955395 2:224924149-224924171 TCTATGTGTTAGGATAGAGGTGG - Intronic
1169890084 20:10443402-10443424 GCTAAGCGTGAGAGTAGAGGTGG + Intronic
1170059240 20:12242177-12242199 CATATGCATGAGAAAAGAGGAGG + Intergenic
1172572937 20:35984477-35984499 AATGTGCAGGAGAATAGAGGAGG + Intronic
1173151117 20:40567039-40567061 GATATGGGAGAGAATACAGGGGG - Intergenic
1173761213 20:45562221-45562243 TGTATGGATGAGAAGAGAGGTGG + Intronic
1176199901 20:63855500-63855522 TGGATGCCTGAGAGTAGAGGAGG - Intergenic
949617584 3:5770682-5770704 TATATGGGTGATACCAGAGGAGG - Intergenic
950107859 3:10399671-10399693 GGTAGGAGTGAGAATAGAGGTGG - Intronic
950996889 3:17509864-17509886 TATATAAGTGAGAATTGAGAGGG - Intronic
951604624 3:24419368-24419390 GATAGGAATGAGAATAGAGGAGG - Intronic
952432494 3:33237320-33237342 TATATGTGTGAAAATAGAAAAGG + Intergenic
953391169 3:42534712-42534734 CAGAAGGGTGAGAATAGAGGGGG + Intronic
953506038 3:43486249-43486271 TATAGGGGAGAGAATAAAGGAGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956723638 3:72139175-72139197 TCCATGGGTGGGAATAGAGGGGG + Intergenic
959743983 3:109754914-109754936 TATATGAGAGAGAAAAGAAGTGG + Intergenic
962249200 3:133824731-133824753 CATATGAGTGAGAATATTGGTGG - Exonic
964157756 3:153606256-153606278 TAAATGTGTGCTAATAGAGGGGG + Intergenic
964586239 3:158306239-158306261 TATATGCCTGAAAACAGAGAAGG - Intronic
966983415 3:185158300-185158322 TATATGCAACAGAATAGTGGGGG - Intergenic
977747379 4:100565783-100565805 TATCTGAGTGAGAATAAAGAGGG + Intronic
979089784 4:116467741-116467763 TATATGGGTTAGGATAAAGGGGG - Intergenic
979578453 4:122324278-122324300 AATATGAGTCAAAATAGAGGAGG - Intronic
981339947 4:143610284-143610306 AATATGAGTGAGATTAAAGGCGG - Intronic
983381934 4:167006777-167006799 AATATGCCTGGGAAAAGAGGCGG - Intronic
983524385 4:168745850-168745872 TATATGCAGGAGAAAAGAGGAGG + Intronic
984390594 4:179126583-179126605 TATATTAGTGAGAGTTGAGGAGG - Intergenic
989348474 5:40456334-40456356 GATATGCGTGGGATTAGAGTAGG - Intergenic
990668973 5:58105690-58105712 TATATACATAAGAATAGATGGGG - Intergenic
991449756 5:66739496-66739518 TATATATGTGAAAAGAGAGGAGG - Intronic
991453098 5:66773506-66773528 TCTTTGAGTAAGAATAGAGGGGG + Intronic
994661425 5:102658949-102658971 TATATAAGTGTGATTAGAGGAGG + Intergenic
995047559 5:107669620-107669642 GGTATGCGGGAGACTAGAGGTGG - Intronic
999050951 5:148523414-148523436 TATATGAGAGAGAAAAGGGGAGG + Intronic
1000371527 5:160541092-160541114 TAGATTGGTGAGAATAGAGGAGG + Intergenic
1001825544 5:174742361-174742383 TATATGCGAGAGATTGGTGGAGG + Intergenic
1003655999 6:8009215-8009237 TATGGGCATGAAAATAGAGGGGG - Intronic
1007312644 6:40958798-40958820 TAGCTGCCTGAGCATAGAGGAGG - Intergenic
1010499205 6:76574697-76574719 TATATGTGTGAAAACAGCGGAGG - Intergenic
1012902872 6:105028188-105028210 TATGTGAGGGAGAATAGTGGAGG + Intronic
1017323682 6:153122159-153122181 TACATACTTGAGAATAGAGGGGG - Intronic
1018809664 6:167288958-167288980 TATCAGCTTGAGAAAAGAGGTGG - Intronic
1020502192 7:8937345-8937367 TATATGCATGAATAAAGAGGAGG - Intergenic
1021494381 7:21258366-21258388 TATATCCATGTGAATAGAGGAGG - Intergenic
1022485898 7:30777430-30777452 TATATGGGTCAGAAAAAAGGTGG - Intronic
1023414974 7:39923366-39923388 TAAATGCTTGAGAATGGAGATGG - Intergenic
1028649838 7:93139250-93139272 TATGACCGTGGGAATAGAGGTGG - Intronic
1029701707 7:102250749-102250771 TATATGCGTGAGAATAGAGGCGG + Exonic
1032576000 7:133055804-133055826 TATATGTGTGAGTATGGTGGGGG - Intronic
1036977454 8:13429949-13429971 TATTTGCGTGTGCATATAGGTGG + Intronic
1039387338 8:37147758-37147780 TAAATGGGTGAAAAGAGAGGAGG - Intergenic
1039659091 8:39444286-39444308 TCTATGATGGAGAATAGAGGTGG - Intergenic
1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG + Intronic
1045725617 8:105169818-105169840 TGTGTGTGTGAGAATAGAGAGGG + Intronic
1046568853 8:115936792-115936814 TATGTGGATGAGAATAGAGTGGG - Intergenic
1051047252 9:12889307-12889329 TCTCTGCCTGTGAATAGAGGAGG + Intergenic
1058956014 9:109949421-109949443 GATATGGGTGAGAATAGGAGTGG + Intronic
1061931989 9:133838077-133838099 AATATGCAGGAGAATAGAGGAGG + Intronic
1198802214 X:140459560-140459582 TTTATGATGGAGAATAGAGGAGG + Intergenic
1199529648 X:148831899-148831921 TATGTGTGTGTGTATAGAGGAGG - Intronic