ID: 1029701839

View in Genome Browser
Species Human (GRCh38)
Location 7:102252326-102252348
Sequence GCTGAAGGGGAGCCATGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029701839_1029701845 -1 Left 1029701839 7:102252326-102252348 CCTCGGCATGGCTCCCCTTCAGC 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1029701845 7:102252348-102252370 CAGGCTGGCATTCCAAGCAGTGG 0: 2
1: 0
2: 2
3: 24
4: 290
1029701839_1029701846 9 Left 1029701839 7:102252326-102252348 CCTCGGCATGGCTCCCCTTCAGC 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1029701846 7:102252358-102252380 TTCCAAGCAGTGGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029701839 Original CRISPR GCTGAAGGGGAGCCATGCCG AGG (reversed) Exonic
900398051 1:2461351-2461373 GCTGAAGGACAGCCTTGCCAGGG - Intronic
900475058 1:2872214-2872236 GCCTAAGGGAAGCCATGCTGGGG - Intergenic
900591412 1:3461939-3461961 GCAGAAGGGCAGCCCTGCCTCGG + Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
901772444 1:11537222-11537244 GCTGAAGGGGAGGGTTGCGGGGG - Exonic
902304433 1:15525382-15525404 GCTAAGGGGAAGCCATGCCCCGG - Intronic
902449784 1:16489791-16489813 ACTGGAGGGAAGACATGCCGAGG + Intergenic
902504651 1:16931269-16931291 ACTGGAGGGAAGACATGCCGAGG - Exonic
902648848 1:17823350-17823372 GCTGGAGGTGAGGCCTGCCGGGG + Exonic
905906386 1:41621212-41621234 GCTGAAGGGGGTCAAGGCCGTGG - Intronic
913078271 1:115359874-115359896 GATGAAGGGCAGCCAGGCAGAGG + Intergenic
915239212 1:154507872-154507894 GCTGAAGGGAATCCAGGCAGAGG - Intronic
919487238 1:198159259-198159281 GCGGAAGGGGCGCCAGGCTGAGG + Intronic
921159348 1:212462389-212462411 GGTGCAGGGGAGCCATGGAGTGG + Intergenic
924835830 1:247646227-247646249 GCTGGAGGGGAGCAATGTCAAGG + Intergenic
1067836114 10:49642830-49642852 CCTGAAGGCCAGCCAAGCCGGGG - Intronic
1070190124 10:74104627-74104649 GCTCAAGATGAGCCATGCGGAGG - Intronic
1071499667 10:86194426-86194448 GCAGAAGGGGAACCATGCCCCGG - Intronic
1071600348 10:86955902-86955924 GCTGATGGGCAGCCCTGCAGGGG - Intronic
1077338969 11:2017615-2017637 GGGGAAGGGGAGCCAGGCGGGGG + Intergenic
1077410622 11:2402301-2402323 GCTGAACAGAGGCCATGCCGGGG + Exonic
1077560688 11:3258395-3258417 CCTGCAGGGGAGCCCTGCCCAGG + Intergenic
1077566584 11:3304223-3304245 CCTGCAGGGGAGCCCTGCCCAGG + Intergenic
1077921783 11:6646984-6647006 GCTGAAGGGGAAACAGGCTGGGG + Intronic
1079243580 11:18737719-18737741 GCTGAAGGGAAGCGCTGCCCTGG - Intronic
1080889993 11:36401127-36401149 GCAGAATGGGAGCGAAGCCGCGG - Exonic
1083638912 11:64134993-64135015 GCTGATCGGGAGCCAGGCAGGGG - Intronic
1084363720 11:68684762-68684784 GCCGAAGGGGAGGCCTCCCGGGG - Intronic
1084480741 11:69418665-69418687 GCCGAAGGGGAGCCAGTCCCGGG + Intergenic
1085645520 11:78219822-78219844 TGTGAAGGGGAACCATGCTGAGG + Intronic
1087812557 11:102623791-102623813 CCAGAAGGAGAGCCATGCTGAGG - Intronic
1088626482 11:111733803-111733825 GCTGAAGGGCAGGCAGGCAGTGG + Intronic
1202821953 11_KI270721v1_random:72797-72819 GGGGAAGGGGAGCCAGGCGGGGG + Intergenic
1091782782 12:3224522-3224544 CCTGAACGGGAGCCAGGCCTGGG - Intronic
1096424607 12:51490585-51490607 GATGAGGTGGAGCCATGCCATGG + Intronic
1103741462 12:123094404-123094426 GCTGAAGCGGAGCCCAGCCAAGG + Intronic
1103861068 12:124014349-124014371 GGGGAAGGGGAGAGATGCCGAGG + Exonic
1104587030 12:130055869-130055891 GCTCAAGGGTAGCCAGGCTGTGG + Intergenic
1104899801 12:132182688-132182710 GCTGAAAGGGAGCAGTGCCTGGG - Intergenic
1107564736 13:41590192-41590214 GCAGAAGGGGAGCCAACCCATGG - Intronic
1108070191 13:46620587-46620609 TCAGAACGGGAGCCATGCAGTGG + Intronic
1111597420 13:90428727-90428749 GCTGAGGGCGAGCCAGGCAGGGG - Intergenic
1113501219 13:110775924-110775946 GCTGAAGGTCAGAGATGCCGTGG - Intergenic
1113725571 13:112597977-112597999 GCCTAAGGAAAGCCATGCCGAGG + Intergenic
1114552262 14:23539624-23539646 GCTGAAGAGGAGCCATGTCGTGG + Intronic
1115751981 14:36503187-36503209 GAGGAAGGGGAGCAAGGCCGTGG - Intronic
1121256573 14:92534702-92534724 GCTGAGGGGCAGCCAGGCAGGGG + Intronic
1124010902 15:25837842-25837864 GTGGAAGGGGAGCCAGGCAGTGG + Intronic
1124617777 15:31255039-31255061 AATGAAAGGGAGCCATGCCCAGG + Intergenic
1127088644 15:55446566-55446588 GATGAAGGGCAGCCAGGCAGAGG + Intronic
1129273347 15:74430864-74430886 GCTGCTGGGGAGCCATTCTGGGG - Intronic
1132841524 16:1980488-1980510 GCTGCAGGCGCGCCAGGCCGCGG + Exonic
1133072270 16:3254467-3254489 GCTAGAGGGGGGCCAGGCCGAGG - Exonic
1135746281 16:25019425-25019447 GCTGAAGGTGAGCAACGCCCTGG - Intergenic
1139328115 16:66167476-66167498 GATGAAGGGGAGCCAAGGAGAGG + Intergenic
1141730914 16:85822296-85822318 GCGGCAGGGGAGCCATGGTGGGG + Intergenic
1142179187 16:88659017-88659039 GGTGGAGGGGAGGCAGGCCGCGG - Intronic
1143101317 17:4506278-4506300 GCTTGAGGGGAGCCATTCTGAGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1146530502 17:33604095-33604117 GCTGAAAGGGAGCCTGGCCCTGG + Intronic
1152243663 17:79173897-79173919 GCTGAAGTGGAGCCCTGCTGGGG + Intronic
1152463271 17:80452213-80452235 GCAGAAGGGGAGCCCTGGCATGG + Intergenic
1154483019 18:14855624-14855646 GATGAAGGGCAGCCAGGCAGAGG + Intergenic
1157478152 18:48036423-48036445 GCTGAAGGGCTACCATGCAGGGG + Intronic
1158591938 18:58785259-58785281 GCAGCAGGGGAGCAAAGCCGGGG - Intergenic
1158907360 18:62026910-62026932 GCTGACGGGGGGCCAAGGCGCGG + Intergenic
1160248416 18:77179782-77179804 GCAGAAGGGGAGGCCTGCTGGGG + Intergenic
1160912786 19:1482541-1482563 GCTGAAGGGGAGGGAGCCCGGGG - Intronic
1162548098 19:11343138-11343160 GGAGAAGGTGAGCCATGCCTGGG + Intronic
1165422240 19:35727979-35728001 GCTGAAGGTGAGCTCTTCCGGGG + Exonic
1165734944 19:38170019-38170041 GCTGGAGGGGGGCCAGGCAGAGG + Intronic
1167158765 19:47754757-47754779 GGTGAGGGGGAGCCAGGCCAGGG + Exonic
1167951080 19:53028275-53028297 GCTGGAGGTGAGACATGCTGGGG - Intergenic
925681067 2:6421565-6421587 GCTGAAAGGGAGCGAAGCCTTGG - Intergenic
937904399 2:127045884-127045906 GCTGGAGGGGAGCCACACAGAGG + Intergenic
939100825 2:137892750-137892772 GCTGAAAGGTAGCCAGGCCGGGG + Intergenic
1169418268 20:5436587-5436609 GGTGAAGGGTAACCTTGCCGTGG - Intergenic
1170870313 20:20200042-20200064 GCTGCAGGGGAGCCTTCGCGGGG - Intronic
1172212933 20:33213681-33213703 GTGGAAGGGGAGCCAGGCAGAGG - Intergenic
1175870321 20:62206260-62206282 CCTGAAGGGCAGACATGCTGAGG + Intergenic
1177947691 21:27492446-27492468 GCAGAAGGGGAGACAGGCCCGGG - Intergenic
1178875802 21:36413109-36413131 CCTGAGGGGGAGTCGTGCCGGGG - Exonic
1180183296 21:46127478-46127500 GCTGAAGGGCAGCCAGACCCAGG - Intronic
1180799569 22:18625518-18625540 GCTGAAGGGCAGTCATGCCCAGG - Intergenic
1180960356 22:19759633-19759655 GCTGAAGTGCATCCCTGCCGGGG - Exonic
1181052070 22:20242661-20242683 ACTGCAGGGCAGCCAGGCCGCGG + Exonic
1181169469 22:21000172-21000194 GCTGAGGGGGAGACTGGCCGTGG + Exonic
1181222147 22:21369748-21369770 GCTGAAGGGCAGTCATGCCCAGG + Intergenic
1181637907 22:24182742-24182764 GCTGAAGGGCAGTCATGCCCAGG + Intronic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1185019909 22:48367957-48367979 GCTGTAGGGGAGCCAGGTGGGGG + Intergenic
956723284 3:72136844-72136866 GTTGAAGGCGAGCTATGCCTAGG + Intergenic
961628484 3:128279728-128279750 ACTGAATGGGGGCCATGCCTGGG - Intronic
968573489 4:1354362-1354384 GCTGGAGGGGCGCCATCCTGTGG + Intronic
969104509 4:4795306-4795328 GCTGAAGGGCAGCAAAGCCAAGG - Intergenic
969623434 4:8290374-8290396 GGTGGAGGGGAGCCATCCAGAGG + Intronic
972168810 4:36319926-36319948 GCTGAAGTGCAGCCTTGCCAAGG + Intronic
973778440 4:54265538-54265560 ACTGAAGGTGAGCCATGCAAAGG - Intronic
974432448 4:61816739-61816761 GCAGCAGGGGAGGCATGCCTGGG + Intronic
975536245 4:75454292-75454314 GCATAAGGGCAACCATGCCGAGG + Intergenic
975973881 4:80073171-80073193 GCTGGAGAGAAGCCACGCCGAGG + Intronic
978371522 4:108034109-108034131 GCCGGAGGGGCGCCATGCCTGGG + Intronic
978659532 4:111108188-111108210 GCTGGAGGGGAGGCATGGCTTGG + Intergenic
981504291 4:145482399-145482421 GCGGAAGGGGAGCGCGGCCGGGG - Intronic
983481008 4:168273960-168273982 GCTGAAGGAGAGCGACGACGGGG - Exonic
983493940 4:168421786-168421808 GCTGAGGGAGAGCGATGTCGGGG - Exonic
984699085 4:182807117-182807139 GCTGCAGGGAGGCCAGGCCGAGG - Intergenic
986471673 5:8082454-8082476 GCTGAAGGTGAGACATGACATGG - Intergenic
986779812 5:11054999-11055021 GCTGAAGCTGAGCAATGCCAAGG + Intronic
989115969 5:37952451-37952473 GCTGAAAGGCAGCGATGCCCCGG - Intergenic
998925133 5:147114830-147114852 GCTGTATGGGAGGCATGCTGGGG + Intergenic
1001018429 5:168162536-168162558 GAAGCAGGGGAGCCATGCAGAGG - Intronic
1003122994 6:3333465-3333487 GCTGAAGTGGAGCGATGGGGCGG - Intronic
1006133774 6:31883681-31883703 GCTGAAAGGGAGCCCTGGTGTGG - Intronic
1006401221 6:33818692-33818714 GGTGAAGGAGAGCCAGGCCTGGG + Intergenic
1007764813 6:44154229-44154251 GCTCAAGGGGAGGAATGCAGAGG + Intronic
1007864452 6:44953355-44953377 GCTGAAGGGGTCCCCTGCCTTGG + Exonic
1010414863 6:75601792-75601814 GCTGAGGGGGAGCCGCGCTGGGG + Intronic
1018434846 6:163750709-163750731 GATGAAGGGGTGCCAGGCCGTGG - Intergenic
1019170039 6:170128783-170128805 GGTCCAGGGGAGCCCTGCCGTGG + Intergenic
1020009900 7:4802074-4802096 GCAGAAGGGCCGCCAGGCCGCGG + Intronic
1026846673 7:73702647-73702669 GCTCAAGCAGAGCCATGCAGAGG + Intronic
1029422294 7:100477845-100477867 GGTGGTGGGGAGCCATTCCGGGG + Exonic
1029585610 7:101468882-101468904 GCTTAATGGGAGCCAGGCCTGGG - Intronic
1029701839 7:102252326-102252348 GCTGAAGGGGAGCCATGCCGAGG - Exonic
1034538230 7:151739131-151739153 GCTACACCGGAGCCATGCCGGGG - Intronic
1035731475 8:1856634-1856656 GCTGAGGGGGAGCCCTGCTAGGG - Intronic
1035747681 8:1973914-1973936 GCTGAAGAGGAGCCGCGGCGAGG + Exonic
1036723904 8:11201639-11201661 GGGGAAGGGGAGCCCTGGCGGGG - Intergenic
1037393168 8:18416070-18416092 GCTGAAGGGGAATTTTGCCGGGG - Intergenic
1041476989 8:58277955-58277977 GCTGAAGGGGAGCCCACACGGGG + Intergenic
1043789515 8:84446770-84446792 GCTGAGGGGGTGCCATGCAGGGG + Intronic
1047204353 8:122791388-122791410 GCTGATTGGGAGCCCTGCCTGGG + Intronic
1049188821 8:141274708-141274730 GCTGAAGGTCAGCCATCTCGAGG + Intronic
1049274471 8:141712909-141712931 GCTGGACGGGAGCGATGGCGGGG + Intergenic
1049310679 8:141932081-141932103 GCTGACCGGGAGCCATGGTGGGG - Intergenic
1049706846 8:144047094-144047116 GCTGAAGGGGCACGGTGCCGGGG - Intergenic
1050196348 9:3088060-3088082 GTTAAAGGGAAGCCTTGCCGAGG - Intergenic
1050972475 9:11894886-11894908 GCTGGAGGTGAGACATGCTGGGG - Intergenic
1057351093 9:94299366-94299388 TCTGAAGGGGAGCCATGCTTTGG - Intronic
1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG + Exonic
1203772744 EBV:57864-57886 GCTGAAGGGGGGCGATGGGGCGG + Intergenic
1192885819 X:75335215-75335237 GATGAAGGGCAGCCAGGCAGAGG + Intergenic
1202028956 Y:20552413-20552435 GATGAAGGGCAGCCAGGCAGAGG - Intergenic