ID: 1029702421

View in Genome Browser
Species Human (GRCh38)
Location 7:102256117-102256139
Sequence CGGCTCCGGCCAGAGCCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029702421_1029702426 -5 Left 1029702421 7:102256117-102256139 CCCGCGGGCTCTGGCCGGAGCCG 0: 1
1: 1
2: 0
3: 14
4: 160
Right 1029702426 7:102256135-102256157 AGCCGCTGGCCTGACGAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1029702421_1029702428 0 Left 1029702421 7:102256117-102256139 CCCGCGGGCTCTGGCCGGAGCCG 0: 1
1: 1
2: 0
3: 14
4: 160
Right 1029702428 7:102256140-102256162 CTGGCCTGACGAGGCAGGATAGG 0: 1
1: 0
2: 2
3: 4
4: 146
1029702421_1029702425 -9 Left 1029702421 7:102256117-102256139 CCCGCGGGCTCTGGCCGGAGCCG 0: 1
1: 1
2: 0
3: 14
4: 160
Right 1029702425 7:102256131-102256153 CCGGAGCCGCTGGCCTGACGAGG 0: 1
1: 0
2: 0
3: 11
4: 419
1029702421_1029702429 1 Left 1029702421 7:102256117-102256139 CCCGCGGGCTCTGGCCGGAGCCG 0: 1
1: 1
2: 0
3: 14
4: 160
Right 1029702429 7:102256141-102256163 TGGCCTGACGAGGCAGGATAGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029702421 Original CRISPR CGGCTCCGGCCAGAGCCCGC GGG (reversed) Exonic
900285758 1:1899603-1899625 AGGCTGCGGACAGAGCCCACGGG + Intergenic
901051187 1:6426600-6426622 AGGCACAGGCCAGAGCCCACAGG + Intronic
901216089 1:7556159-7556181 CCTCTCCGCCCAGAGCCCGCAGG - Intronic
903014945 1:20355648-20355670 GGGCTTGCGCCAGAGCCCGCAGG - Intergenic
903263487 1:22143270-22143292 CGGCTGCCGCCTTAGCCCGCGGG + Intronic
903352052 1:22723271-22723293 CAGCCTCGTCCAGAGCCCGCAGG + Intronic
904601373 1:31674437-31674459 CGGCCCAGGCCACAGCCCTCTGG + Intronic
906203663 1:43975507-43975529 GCGCTCCAGCCAGATCCCGCCGG - Intronic
907809074 1:57850618-57850640 GGGCTCCCTCCAGAGCCCACAGG - Intronic
911498934 1:98662064-98662086 CGGGTGCGGCCAGAGCTGGCAGG - Intronic
912413593 1:109493937-109493959 CCGCTCCCGCGAGAGCCCGGAGG - Intergenic
920528754 1:206686177-206686199 CGGCTCCGGGGAGAGGCCGGCGG + Intronic
922234403 1:223712467-223712489 CGGCTGAGGCCACACCCCGCGGG + Exonic
922744925 1:228038279-228038301 CGGTCCCCGCCGGAGCCCGCCGG - Intronic
924883722 1:248189524-248189546 CTGCTCTGTTCAGAGCCCGCAGG - Intergenic
1062800529 10:376247-376269 CGGCCCCCGACAGAGCCGGCAGG + Intronic
1066065766 10:31759932-31759954 CGGGTCCGGACAGGCCCCGCAGG + Intergenic
1074032753 10:109704930-109704952 CCGTTCTGGCCAGAGCCCACAGG + Intergenic
1076007174 10:126956934-126956956 AGGCTCAGGCCAGAGCCCACAGG + Intronic
1076171581 10:128324351-128324373 CGGCTGCGGCCAGAGGTCGGAGG - Intergenic
1076726677 10:132417136-132417158 CGGCTGCGTGCAGAGCCCACTGG + Exonic
1077136534 11:1002250-1002272 CTGCTCCGCCCACAGCCAGCGGG - Intronic
1078225148 11:9384909-9384931 CGCCTCCGGCCAGGCCCCGGGGG - Intronic
1078949336 11:16111854-16111876 CAGCTGCTGCCAGAGTCCGCTGG + Exonic
1079055982 11:17207474-17207496 CGGCTCCAGCCCGGTCCCGCGGG + Intronic
1082243239 11:49892227-49892249 CGGCCCTGCCCAGAGGCCGCGGG - Intergenic
1083246117 11:61429648-61429670 CGGCTCCGGCCAGAGCCCCCAGG + Intronic
1083310366 11:61780746-61780768 CTGCTCCGGCCCCAGCCCCCTGG + Exonic
1084146258 11:67266831-67266853 CGGCCCCGGCCCGACCCCGCGGG + Intronic
1084310207 11:68312474-68312496 CGGCTCCGGGGGGCGCCCGCGGG + Intergenic
1087135735 11:94716986-94717008 TGCCTCTGGCCAGAGCCAGCAGG + Intronic
1089763384 11:120745189-120745211 TGACTCCGGCCAGAGTCCACTGG + Intronic
1090709723 11:129374160-129374182 CAGCTCCGCAGAGAGCCCGCCGG + Intergenic
1092905114 12:13093788-13093810 GGGCTCCTGCCAGAGCCATCTGG - Intronic
1096230802 12:49895771-49895793 GGGCTCAGCCCAGAGCCCCCTGG - Intronic
1096573931 12:52540892-52540914 CGGCTCCTGTCAGTGTCCGCAGG + Intergenic
1102710190 12:114919141-114919163 AGGCTCAGGCCAGAGACCTCTGG - Intergenic
1104763230 12:131310769-131310791 CAGCTGCGGCAAGAGCCGGCCGG + Intergenic
1115399251 14:32939161-32939183 CGGCCCCGGCCACCGCCCGCCGG + Intronic
1120865608 14:89293171-89293193 CTGCTCTGTGCAGAGCCCGCTGG - Intronic
1121050507 14:90816500-90816522 CGGCTCCGGCCCTGGCCGGCAGG - Intergenic
1121102303 14:91258345-91258367 CAGCTCAGGCCTGAGCCTGCTGG - Intergenic
1122220828 14:100238518-100238540 CGGCCCCGGCCCGAGGCGGCGGG + Intronic
1122627434 14:103091587-103091609 CAGCCACGCCCAGAGCCCGCGGG + Intergenic
1122689630 14:103525993-103526015 CGGCTCCGGCCTGGCGCCGCTGG + Intergenic
1122788810 14:104175911-104175933 CAGCTCCGGCAAGCGCCCCCAGG - Exonic
1122938370 14:104970272-104970294 TGGCTCCAGCCAGGGCCAGCGGG - Intronic
1123024025 14:105415181-105415203 CGGCTCGGTCCGGAGCCAGCCGG - Intronic
1124789956 15:32718085-32718107 CGGCCGCGGCCAGAGCCGCCGGG - Exonic
1128742922 15:70096084-70096106 CGGCTCCTGCCATCCCCCGCGGG - Intronic
1130652568 15:85770427-85770449 CGGCCCAGGGCAGAGCCTGCTGG - Intronic
1130979624 15:88803622-88803644 CCGCTGCGGCCACAGCCCGAGGG + Exonic
1130990684 15:88873983-88874005 AGGCTCCTCCCAGTGCCCGCTGG - Exonic
1132013911 15:98299689-98299711 CAGCTCCGGCTGGAGCCCTCTGG - Intergenic
1132552424 16:559082-559104 CGGCTGCTGGCAGAGCCCCCTGG - Intergenic
1132557546 16:579215-579237 TGCCTCCGGCCTGTGCCCGCTGG + Intronic
1132644165 16:991180-991202 CGGAGCCGGCCAGAGCCTCCCGG - Intergenic
1132864328 16:2086098-2086120 GGGCTCCCGGCAGAGCCTGCTGG + Intronic
1132906808 16:2286648-2286670 CTGCCCTGGCCAGAGCCCCCAGG - Intronic
1133310944 16:4846836-4846858 TGGCACCGGCCAGATCTCGCAGG + Intronic
1135721751 16:24823543-24823565 CGGGTCCAGCCAGAGCCGGCTGG + Exonic
1136447891 16:30335198-30335220 CGGGTTCCGCCTGAGCCCGCAGG + Intergenic
1139530045 16:67538291-67538313 CGGACCCGGCCGGAGCCCGCTGG + Intronic
1140219383 16:73032949-73032971 GGGCTGCGGCCAGACCCCACTGG + Intronic
1142113872 16:88346362-88346384 CGGCTCCTGGCAGAACTCGCTGG + Intergenic
1142119920 16:88382225-88382247 TGGCTCCAGGCAGAGCCCCCTGG - Intergenic
1142240132 16:88941220-88941242 CGGCTCCGGCCACCCCGCGCGGG + Intronic
1143078498 17:4365489-4365511 CGCCCCGGGCCAGAGCCTGCGGG + Intronic
1143719410 17:8799283-8799305 CGCCCCCGGCCACAGCCCCCAGG + Exonic
1148859443 17:50596404-50596426 CGGCGCAGGCCAGACCCCCCAGG - Intronic
1148880236 17:50719838-50719860 GGGCTCAGGCCAAGGCCCGCGGG - Intronic
1152511630 17:80793643-80793665 CTACTCCGGACAGAGCCCCCCGG + Intronic
1152741798 17:82021661-82021683 CAGCTCTGGCCAGAGCCCCTGGG + Intronic
1154327260 18:13400482-13400504 AGGCTCCGTCTGGAGCCCGCAGG - Intronic
1160719124 19:589881-589903 CGCCGCCGGCCGGAGCCCGAGGG - Exonic
1160775440 19:853128-853150 GGGGTCCGTCCAGGGCCCGCGGG + Intronic
1161588602 19:5118562-5118584 CGGCTTCTGCCTGAGCCCCCTGG + Intronic
1162421573 19:10568719-10568741 CTGTTCGGGCCAGCGCCCGCCGG - Exonic
1162582311 19:11538900-11538922 CTGCCCCCGCCAGAGCCCACCGG + Exonic
1163123829 19:15233436-15233458 CGGCGCCGGGCCGAGGCCGCTGG - Intergenic
1164648171 19:29873854-29873876 CGGCACCGGCCACCGCGCGCTGG - Intergenic
1164816236 19:31205562-31205584 GGGCTCAGCCCAGAGCCAGCTGG - Intergenic
1164855494 19:31517638-31517660 GGGCTGTGGCCAGAGGCCGCGGG + Intergenic
1165752442 19:38268529-38268551 CGGCTCCTGCCAGGGACTGCTGG - Intronic
1167793300 19:51693532-51693554 CGGCACTGGCCAGAGCCAGCAGG - Intergenic
1168586745 19:57600086-57600108 CCGCTCCGCCCAGAGTCCGATGG + Exonic
925750825 2:7089570-7089592 CGGCTCCTGCCACAGCTCTCTGG - Intergenic
925970945 2:9106161-9106183 CGGCTCAGGCCTGACCCCCCAGG + Intergenic
926219667 2:10926251-10926273 GGGCTCCAGGCAGAGCCCCCTGG - Intergenic
930872716 2:56184490-56184512 CGGCACCGCCCAGGGGCCGCTGG - Exonic
946376451 2:219312768-219312790 CGGCTCCGGCCTTGGCCAGCCGG - Intergenic
949007105 2:241655999-241656021 AGGCTCTGGCCAGATCCCCCAGG + Intronic
1168800852 20:642481-642503 CGGCCCCTTCCAGAGCCCGAGGG - Intergenic
1168815498 20:734000-734022 CTGCTCCGGCCTGAGGCCGCTGG + Intergenic
1168832528 20:854464-854486 AGGCTCCAGACAGAGCCCCCTGG - Intronic
1171406306 20:24914537-24914559 CGGGTCCGGCCGGAGCTCCCCGG + Intergenic
1171427386 20:25057537-25057559 CAGCTCGGGCCGGCGCCCGCGGG - Intronic
1173221689 20:41137248-41137270 CGGCCCCGGACACAGCCCGGCGG - Intronic
1174258744 20:49278123-49278145 CGGCTCCGCCCAGGGTCTGCGGG - Exonic
1174258802 20:49278276-49278298 CCGCGCCCGCCTGAGCCCGCCGG - Intronic
1174342785 20:49908226-49908248 AGGCGCCGTGCAGAGCCCGCAGG + Exonic
1174420354 20:50395457-50395479 AGTCTCTGGCCAGAGCCTGCGGG + Intergenic
1175908036 20:62391480-62391502 CAGCCCCAGCCAGAGCCCCCAGG - Intronic
1176243422 20:64085300-64085322 TGGCTGGGGCCAGAGCCCCCTGG - Intronic
1179052126 21:37896996-37897018 GGGCTCCTGCCAGAGCCAGGAGG + Intronic
1179522365 21:41953723-41953745 TGGCTGCGGCCACAGCGCGCTGG + Exonic
1179580767 21:42342687-42342709 GAGCTCCTGCCAGAGGCCGCCGG - Intergenic
1179874623 21:44261753-44261775 CGGCTCCGGGTACAGCCAGCTGG + Exonic
1180830955 22:18905923-18905945 GGTCTCGGGCCAGAGCCCACAGG - Intergenic
1180876834 22:19178634-19178656 CGGCGGCCGCCAGAGCGCGCGGG + Exonic
1180960802 22:19761446-19761468 CGGCTCCGGCGACAGCCGCCCGG + Intronic
1181057899 22:20268469-20268491 CGGCCCGGGCCGGAGCCGGCCGG + Exonic
1181068889 22:20320411-20320433 GGTCTCGGGCCAGAGCCCACAGG + Intergenic
1182424916 22:30266811-30266833 GTGCTCCGGCCCGCGCCCGCTGG + Exonic
1182903982 22:33920840-33920862 CGGCTCCGGCCAGCGGCGCCCGG - Intronic
1183380046 22:37486141-37486163 GGGCTCCAGCCAGGCCCCGCGGG + Exonic
1184810973 22:46831685-46831707 AGCCTTCTGCCAGAGCCCGCTGG - Intronic
1185220060 22:49624719-49624741 AGGCTCCCTCCAGAGCCCTCAGG + Intronic
1185415209 22:50705755-50705777 GTGCTCAGGCCAGAGCCAGCCGG + Intergenic
1203255961 22_KI270733v1_random:138102-138124 CGGCTAAGTCCAGAGCTCGCGGG - Intergenic
1203281042 22_KI270734v1_random:131194-131216 GGTCTCGGGCCAGAGCCCACAGG - Intergenic
950767747 3:15286099-15286121 CTGCTCTGGCCAGGGCCCGCCGG - Intronic
960586262 3:119323373-119323395 GGGCTGCGGCCACACCCCGCCGG + Intronic
961540820 3:127598256-127598278 GCGCTCCGCCCAGAGCCCGGAGG - Exonic
962009783 3:131381800-131381822 CGGCCATGGCCGGAGCCCGCAGG + Exonic
967880600 3:194298707-194298729 AGGATCTGGCCAGCGCCCGCAGG + Intergenic
968562200 4:1290021-1290043 CGTCTCCAGCCAGTGCCCTCGGG + Intronic
970407638 4:15778750-15778772 CGGGTCAGCCGAGAGCCCGCCGG + Intronic
973697813 4:53507997-53508019 TTGCTCCGGCCAGAGTCCACTGG + Exonic
976512736 4:85930068-85930090 CGGCTGCTTCCAGTGCCCGCCGG - Intronic
977573931 4:98658030-98658052 CTGCTCCGGCAAGCGCCTGCGGG + Intronic
981346489 4:143683198-143683220 CAGCTCCGGACAGAGCGAGCAGG + Intronic
985772777 5:1823612-1823634 GGTCTCCGGCCAGAGACAGCAGG + Intergenic
987374230 5:17218590-17218612 CGGCCCCGGCCCGGGCCCGGGGG + Intronic
988464644 5:31476752-31476774 AGACTCCTGCCAGAGCCCACAGG + Intronic
992690437 5:79236272-79236294 CAGCGCCGGCCTGACCCCGCGGG + Exonic
992939942 5:81751506-81751528 CGGCTCCGGCCGGAGACTCCAGG - Intronic
993903012 5:93596983-93597005 CCGCTCCGCCCTCAGCCCGCAGG - Intergenic
996862649 5:128083688-128083710 CGGCTCCGGCAGCAGCACGCGGG - Intergenic
997595618 5:135105326-135105348 GGCCTCAGGCCAGAGCCTGCTGG + Intronic
998406703 5:141878342-141878364 CTGCTGCGCCCAGAGCCAGCCGG - Exonic
1001441871 5:171749743-171749765 CGGCTCAGGCCAGAGCCTCGTGG - Intergenic
1004806205 6:19205955-19205977 CTGCTCCTGCCAGAGTCCTCTGG - Intergenic
1007108915 6:39301758-39301780 CGGCTCTGGCCACAGCCTTCAGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007764554 6:44152884-44152906 CAGCTCAGGCCAGACCCAGCTGG + Intronic
1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG + Intergenic
1015626210 6:135182512-135182534 CGCCTGGGGGCAGAGCCCGCGGG - Intronic
1016330177 6:142946222-142946244 CGGCTCCCGCCTGAGCCCGGCGG - Intergenic
1018668930 6:166163825-166163847 CTGCTCTGGCCAGGGCCGGCTGG - Intronic
1019515684 7:1438905-1438927 TGGCTTCGGCCGGAGCCCCCTGG - Exonic
1019651000 7:2158483-2158505 GGGCTCCAGCCAGAGCCCTGCGG + Intronic
1019743498 7:2687513-2687535 CGGCTCCAGACAGAGCCCAGAGG - Intronic
1024920318 7:54546848-54546870 CGGCTCCGGGCAGGGCCGTCAGG - Intronic
1026771880 7:73207386-73207408 TGGCGCTGGGCAGAGCCCGCCGG + Intergenic
1027012748 7:74760782-74760804 TGGCGCTGGGCAGAGCCCGCCGG + Intergenic
1027075292 7:75185271-75185293 TGGCGCTGGGCAGAGCCCGCCGG - Intergenic
1029702421 7:102256117-102256139 CGGCTCCGGCCAGAGCCCGCGGG - Exonic
1035266817 7:157693693-157693715 CGGCTCCGGGCAGAGGCCAGAGG + Intronic
1035777814 8:2203180-2203202 CGGGTCCTGCCAGAGCCTTCGGG - Intergenic
1036287773 8:7459798-7459820 GGGCTCAGGCCAGAGCAGGCAGG + Intronic
1036333703 8:7851730-7851752 GGGCTCAGGCCAGAGCAGGCAGG - Intronic
1039579354 8:38651181-38651203 CGGCGGCGACCAGAGCCTGCTGG + Intergenic
1040055952 8:43056722-43056744 CGGCGCCGGCGCGAGACCGCGGG + Intronic
1041107971 8:54459567-54459589 CGACTCGGCCCAGAGCCCGCGGG + Exonic
1041145846 8:54875233-54875255 AGGCGCCGGCGGGAGCCCGCCGG + Intergenic
1042691025 8:71499001-71499023 TGGCTCCTGCCAGAGCTGGCAGG - Intronic
1045063389 8:98426707-98426729 CAGCTCCCGCCAGACCCAGCGGG + Intronic
1049024388 8:139978881-139978903 CTGCTCCGTCCAGAGCACTCTGG + Intronic
1049109604 8:140635138-140635160 CGGCCCCGGCCCCAGCCCGCGGG + Intronic
1049592985 8:143471077-143471099 CTGCTCCGGCCAGCACCCACTGG + Intronic
1052146848 9:25060853-25060875 CTGCTCCGTTCAGAGCCAGCAGG + Intergenic
1059145545 9:111896666-111896688 CGGCGCCGGCGAGAGCGCGCCGG - Intergenic
1060478030 9:123999942-123999964 CGGCTCCGGGCCGGCCCCGCAGG + Intergenic
1062144842 9:134983293-134983315 CGGCTACCCACAGAGCCCGCAGG + Intergenic
1192992169 X:76471832-76471854 CTGCTCCCTCCAGAGCCAGCAGG - Intergenic