ID: 1029703198

View in Genome Browser
Species Human (GRCh38)
Location 7:102261160-102261182
Sequence CTGAACTTCTTGGAAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029703198_1029703205 18 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703205 7:102261201-102261223 GGAAGGGCCCTGGTCGAGCATGG 0: 1
1: 0
2: 0
3: 11
4: 158
1029703198_1029703200 -3 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703200 7:102261180-102261202 CAGACTCTTAGAATACCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1029703198_1029703203 8 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703203 7:102261191-102261213 AATACCAACAGGAAGGGCCCTGG No data
1029703198_1029703202 2 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703202 7:102261185-102261207 TCTTAGAATACCAACAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1029703198_1029703201 1 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703201 7:102261184-102261206 CTCTTAGAATACCAACAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 116
1029703198_1029703207 22 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703207 7:102261205-102261227 GGGCCCTGGTCGAGCATGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1029703198_1029703206 21 Left 1029703198 7:102261160-102261182 CCTGTCTTTTCCAAGAAGTTCAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1029703206 7:102261204-102261226 AGGGCCCTGGTCGAGCATGGTGG 0: 1
1: 0
2: 0
3: 21
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029703198 Original CRISPR CTGAACTTCTTGGAAAAGAC AGG (reversed) Intronic
903857690 1:26346353-26346375 ATGTACTTCTTGGAAAAGATGGG + Exonic
904194346 1:28773828-28773850 CAGAATTTCTTGGAAAAAAGTGG - Intergenic
904526200 1:31135810-31135832 CTTACATTCTTAGAAAAGACTGG - Intergenic
904891935 1:33785808-33785830 GTGATCTTGTTGGAAAAGAAAGG - Intronic
905697257 1:39983998-39984020 ATGAACTAATTGGAAAAAACTGG + Intergenic
906575755 1:46887886-46887908 ATGAACATCTAGGAAAAGAGAGG + Intergenic
906596221 1:47080010-47080032 ATGAACATCTAGGAAAAGAGAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907581910 1:55579745-55579767 CTGAACTTCCTGCAAGAGATGGG - Intergenic
910454899 1:87387080-87387102 CAGAACTTCTTGGTTAAGATGGG - Intergenic
911791278 1:102018547-102018569 CTCAACTTCTTGGAAATTAAGGG + Intergenic
912566428 1:110590847-110590869 CTCAACTTCTTGGGTCAGACTGG - Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
918046188 1:180942349-180942371 CTGAACTCCCTGGAACAGAAGGG - Intronic
918987899 1:191657445-191657467 CTGGAATACTTGTAAAAGACTGG - Intergenic
919938267 1:202269204-202269226 CTGAGATTCTTGGTAAACACAGG + Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921992180 1:221379063-221379085 CCTTACCTCTTGGAAAAGACAGG + Intergenic
923606420 1:235447412-235447434 ATGAACTTCTTTCCAAAGACGGG - Intronic
923942024 1:238838396-238838418 CTGGTCTTATTGGAAAAGACAGG - Intergenic
923997561 1:239512492-239512514 CTGAAGTTCTTGGCAAACAGTGG - Intronic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
1063881008 10:10532101-10532123 CTCAAGTTCTTTCAAAAGACAGG + Intergenic
1064475238 10:15681284-15681306 GTGAACTTCTTGGCCATGACGGG + Intronic
1065771180 10:29080266-29080288 CTGAACATCTTGGAAACTTCAGG - Intergenic
1066055812 10:31678982-31679004 CTGATTTTCTTGGAAATGATGGG + Intergenic
1067970382 10:50963483-50963505 CTGTACACCTTGGAAAAGTCAGG + Intergenic
1068437579 10:57012500-57012522 CTGAAACTTTTGGAAAAGAAAGG - Intergenic
1068751200 10:60594428-60594450 ATGAACTTCTTCGAAAAATCTGG + Intronic
1068892904 10:62166132-62166154 CTTAACTTCTTTCCAAAGACAGG - Intergenic
1070824722 10:79384477-79384499 CTCAACACCTTGGAGAAGACGGG + Exonic
1071085845 10:81867912-81867934 CAAAACTTGTTGGAAAAGGCAGG + Intergenic
1072646282 10:97257189-97257211 CTGAATTACTTAAAAAAGACAGG - Intronic
1076052842 10:127349109-127349131 TTTAACTTCATGGGAAAGACTGG - Intronic
1076198640 10:128540413-128540435 CTGAACTTCCAGGGAATGACGGG + Intergenic
1076711995 10:132341772-132341794 CTGCACATCTTAGGAAAGACTGG + Intronic
1077525616 11:3062790-3062812 CTGAACATCTGGGAGAACACGGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1079451159 11:20600982-20601004 CTGAACTTTTTTTAAAAGAAAGG - Intronic
1081078544 11:38708850-38708872 CTGGACTTATTGGAAAATTCTGG + Intergenic
1083965606 11:66042164-66042186 CTTATCCACTTGGAAAAGACAGG + Exonic
1085512226 11:77094220-77094242 CTGAACAACTGGGAAAAGTCAGG - Intronic
1086160504 11:83717115-83717137 CTGTACTTTCTCGAAAAGACAGG - Intronic
1087651577 11:100874581-100874603 GTGAACTCCATGGAAAATACGGG - Intronic
1088067713 11:105741346-105741368 CTGAAGCTCATGGAAAAGAAAGG + Intronic
1088747485 11:112816513-112816535 CTGAAGTTCAGGGAAAAGTCAGG - Intergenic
1090629495 11:128633708-128633730 CTGAGCTTGTGGGAGAAGACAGG - Intergenic
1092552394 12:9517369-9517391 CTGTCTTTCTTGGAAAAGAAAGG - Intergenic
1094072502 12:26433300-26433322 CTTTACTTCTGGGAAAGGACTGG - Intronic
1094519726 12:31173242-31173264 CTGTCTTTCTTGGAAAAGAAAGG + Intergenic
1095637071 12:44447276-44447298 TTAAATTTCTTGGTAAAGACTGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099510792 12:83534271-83534293 CTGAACTTCTTCCACATGACAGG + Intergenic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1102198027 12:111038039-111038061 CCAAACTCCTTGGAAAAGTCCGG - Intronic
1104010947 12:124929581-124929603 CTGAACTTCCTGGAGCAAACCGG + Intergenic
1105820400 13:24076266-24076288 CTGAACTCCTGGGAAATGAGTGG + Intronic
1108822391 13:54369204-54369226 GTGAACTTCATGGATAAGAAGGG - Intergenic
1108851180 13:54731677-54731699 CTTAGCTTCATGAAAAAGACAGG - Intergenic
1110136150 13:72069608-72069630 CTGAACATATGGGAAAAGAAAGG - Intergenic
1112438249 13:99406987-99407009 CTGAAAAACTTGGAAAACACAGG - Intergenic
1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG + Intergenic
1117862781 14:60110213-60110235 TTGAACTTCTTGGATTTGACAGG + Intronic
1119090126 14:71773422-71773444 CCGATGTTCTTAGAAAAGACAGG - Intergenic
1120946986 14:90007135-90007157 CTGAATTTGTTTGAAAGGACAGG - Intronic
1121181847 14:91935048-91935070 CTGAACTTTTTGGAAATGGATGG + Intronic
1126029056 15:44478139-44478161 GTGAATTCCTTGGAAAAGATTGG + Intronic
1127058278 15:55154594-55154616 CTGAATTTCTTCAAAAAGTCAGG + Intergenic
1127627858 15:60797890-60797912 CCTAACTCCTGGGAAAAGACTGG - Intronic
1127688322 15:61370151-61370173 CTGAAATCCATGGAATAGACTGG - Intergenic
1130366980 15:83249523-83249545 CTGAACATCTTACAAAACACAGG + Intergenic
1131583822 15:93672291-93672313 CTGAACATCGTGGAAAACTCAGG - Intergenic
1132414064 15:101608206-101608228 CTGACCTTCCTGGAAATTACAGG - Intergenic
1134275514 16:12772438-12772460 CTGAACTTCAAGGTAAAGAAGGG - Intronic
1134753979 16:16650230-16650252 CTGAACTTATAGGACAAGATGGG - Intergenic
1134992080 16:18708814-18708836 CTGAACTTATAGGACAAGATGGG + Intergenic
1135537812 16:23307752-23307774 CTGAGCTTGTTGGAAATGCCAGG + Intronic
1137845443 16:51683679-51683701 CTGATCTTCCTGGAAGAGATTGG - Intergenic
1138454442 16:57113324-57113346 ACGAACTTCTTGGAGAAGGCGGG - Exonic
1140281596 16:73559702-73559724 CAGAACTTCTTGGAATAAAGAGG + Intergenic
1142813510 17:2407789-2407811 CTGAACCACTGGTAAAAGACAGG + Intronic
1144441204 17:15283790-15283812 CTGACCTGTTTGGAAAATACAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1148127624 17:45245081-45245103 CTGCACTTCCTGGACAAGGCGGG + Exonic
1153764620 18:8363668-8363690 CTGAACCTCTTGAATAAGATGGG + Intronic
1154203211 18:12314325-12314347 CTGAACCTCAAGGAGAAGACTGG - Intronic
1155195686 18:23471902-23471924 CTGAAGTTCTAGGGAAAGTCAGG + Intronic
1156457720 18:37304069-37304091 CTGAATTTTTTTGAACAGACTGG + Intronic
1161082539 19:2318526-2318548 CTGACCTGCTCGGAAAAGACTGG - Intronic
1162838077 19:13334660-13334682 CAGGACTTCTGGGAAAAGACTGG + Intronic
1167822906 19:51945683-51945705 CTGAACTTCTGGCAACAGGCTGG - Exonic
1168661583 19:58171599-58171621 CTCAACTTCTTTCAAGAGACTGG + Intergenic
926014073 2:9433572-9433594 CTGAACTTCTTAGAGAAAAAGGG - Intronic
927150281 2:20191637-20191659 TTGAACTCATTAGAAAAGACTGG - Intergenic
928161765 2:28933423-28933445 CAAAACTTCTGGGAAAAAACAGG + Intronic
929969587 2:46562560-46562582 CTGAACTTCTTGGAACACAGAGG + Intronic
930573672 2:53119063-53119085 CTCAATATCATGGAAAAGACAGG + Intergenic
931088086 2:58856286-58856308 ATGAAGTTCTAGGGAAAGACAGG + Intergenic
932426488 2:71639610-71639632 CTGAACTGCTTGGAACTGAACGG - Intronic
933558298 2:83859461-83859483 GTAAACTTCTTGGAGGAGACAGG - Intergenic
936660510 2:114537814-114537836 CAGAAATTCTTAGAAAAAACTGG - Intronic
937461834 2:122095893-122095915 CTGAACTGCTAGAAAATGACTGG + Intergenic
940010415 2:149048795-149048817 GTGATCTTCTTGTAAAATACTGG + Intronic
942658282 2:178237665-178237687 CTGAACATCCTGCAACAGACAGG - Intronic
943051231 2:182915731-182915753 CAGTACTTCATAGAAAAGACAGG - Intronic
944279777 2:197882249-197882271 CTTAACTTCTTGGAACATGCTGG - Intronic
944647732 2:201796344-201796366 CTGAACTTCATGAAAAAGGAGGG + Intronic
945033746 2:205686745-205686767 CTGAATTTCTTCTAAAAGATAGG + Intronic
947396082 2:229688156-229688178 CGGACCTTCCTGGAAAGGACTGG + Intronic
947813646 2:233021699-233021721 CTGACCTTCCAGGAAAAGAGGGG + Intergenic
1170032879 20:11960596-11960618 CTCAGCTTCTTTGAAAAGAAGGG + Intergenic
1170112001 20:12815179-12815201 CTGAGCTTCTTTAAAAAGCCTGG + Intergenic
1170654150 20:18270049-18270071 CTCAACTTCTTAGAAAAGGATGG - Intergenic
1173865469 20:46309661-46309683 CTGAAGTTCATGGCAAAGAGGGG + Intergenic
1178417621 21:32416653-32416675 TTGAACTTCTTGGAGAAAAAAGG - Intronic
1178547674 21:33506501-33506523 ATAAATGTCTTGGAAAAGACTGG + Intronic
1179375239 21:40844918-40844940 CTGAACTCCTTGGAAAGGCCTGG - Intronic
1181600409 22:23948688-23948710 TTGAACTCCTTGGACAGGACTGG + Intergenic
1181608101 22:23992639-23992661 TTGAACTCCTTGGACAGGACTGG - Intergenic
1182089191 22:27582678-27582700 TTTAATTTTTTGGAAAAGACAGG + Intergenic
1183170437 22:36183744-36183766 CTGCACTTATGGGAAATGACGGG - Intergenic
1183862712 22:40681308-40681330 CGGAACTTCGTGGAAGAGATGGG - Exonic
949169197 3:978462-978484 CTGAACTTTTTGAAAAAGAAGGG + Intergenic
949380725 3:3442757-3442779 CTGAACTTATTTGAAAAAAATGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950856391 3:16109614-16109636 CTCAACTTCCTGGAAAAGTGTGG + Intergenic
951900442 3:27653005-27653027 AGGAGATTCTTGGAAAAGACTGG - Intergenic
952252531 3:31668675-31668697 CTGATCTTCTTGGGATACACTGG + Exonic
953358212 3:42272326-42272348 CTGAGTTTCCTGGAAAGGACAGG + Intergenic
956229333 3:66997018-66997040 TTGAACTTCTTGATAAAGAAAGG - Intergenic
957352465 3:79043578-79043600 CTGTATTTCTTGCAAACGACTGG + Intronic
958780254 3:98532445-98532467 CTGAATTTCCTGGATACGACTGG - Exonic
959179874 3:102964624-102964646 CTGAAGTTCCAGGAAAAGACAGG + Intergenic
961336522 3:126183457-126183479 CTGCATTTCATGGAAAAGAAGGG + Intronic
961602091 3:128070228-128070250 CAGAACTTCTTCCAAAAGAGAGG + Exonic
961919162 3:130408076-130408098 CTGAGCACCTTGAAAAAGACAGG + Intronic
962017042 3:131452440-131452462 CAGAACTACCTGGAAAAGGCAGG + Intergenic
963330013 3:143903734-143903756 CTGAAGTTCTTGGCAAAGCATGG - Intergenic
963644067 3:147891995-147892017 TAGAACTTCTTGGAATAAACAGG + Intergenic
964785947 3:160396713-160396735 CTGGCCTACCTGGAAAAGACTGG - Intronic
964871317 3:161316440-161316462 CTGGCCTTCTTGGAAAAGATGGG - Intergenic
965576286 3:170221914-170221936 CTGAAGGTCCTGGAAATGACTGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966219590 3:177537496-177537518 CTGGACTTGTTAGAAAATACAGG + Intergenic
966551341 3:181207503-181207525 CTGAAACTATTGGAAAAGCCTGG + Intergenic
967898886 3:194426616-194426638 CTGAACATCTTCCCAAAGACAGG + Intronic
969463073 4:7339019-7339041 CTGCACCTCTTGGCCAAGACGGG + Intronic
969976402 4:11106969-11106991 CTGAACATGTTGCAACAGACTGG - Intergenic
973169242 4:47118903-47118925 CTGAAATATTTGGAAAAGAGAGG + Intronic
979698906 4:123644986-123645008 CTGAAATTCTTGAGAATGACTGG - Intergenic
979833559 4:125331425-125331447 GTTAACTGATTGGAAAAGACTGG + Intronic
981135038 4:141201101-141201123 CTGAAATTATTGGTAAAGATTGG - Intronic
981610005 4:146583268-146583290 CACAAATTCTTGGAAAGGACTGG + Intergenic
982357308 4:154485116-154485138 ATGAACTTCTGGGAATATACAGG + Intronic
985726269 5:1517400-1517422 CTGTACTGCTTGGACATGACTGG - Intronic
986394606 5:7316006-7316028 CTGTGATCCTTGGAAAAGACAGG - Intergenic
990048188 5:51460693-51460715 CTGATTTTCTTGGAAAATAAAGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991214371 5:64145330-64145352 CTGAACTTCTTGGAACAGGGAGG + Intergenic
993129297 5:83875332-83875354 CTGATTTTCCTGGAAAAGGCTGG - Intergenic
994404037 5:99320485-99320507 CTGAACTTCTGGTAACAGGCCGG + Intergenic
994736390 5:103562090-103562112 TTGAGCTTCTTGGAAAACAAGGG - Intronic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
996818750 5:127602257-127602279 CTGAACTTCAGGGAAAAGGTTGG - Intergenic
997019114 5:129976066-129976088 CTGATCTTCTTGAATAAAACTGG - Intronic
1000915485 5:167075964-167075986 CTGAAAACCTGGGAAAAGACTGG - Intergenic
1006744248 6:36330359-36330381 CTGAACTTCTTCGTGAGGACGGG - Exonic
1007706288 6:43793484-43793506 CTAAACATCCTGGAACAGACAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017254551 6:152318181-152318203 CAGAAATTCTTGGAACAGAATGG - Exonic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1022889053 7:34677150-34677172 CGGGACTACTTTGAAAAGACTGG + Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026586332 7:71659014-71659036 CTGAACTGTGGGGAAAAGACTGG - Intronic
1027650899 7:80867556-80867578 CTGAGCATCTAGGACAAGACAGG - Intronic
1029676486 7:102072977-102072999 AAGAACTTCTTGGAATAGAATGG - Intronic
1029703198 7:102261160-102261182 CTGAACTTCTTGGAAAAGACAGG - Intronic
1030609842 7:111677489-111677511 TTGAACTTCTTGGAAAACTAAGG - Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032916476 7:136495514-136495536 CTGAAAGTCATGGAAAATACAGG - Intergenic
1033824563 7:145173649-145173671 CTTTAGTTCTTGGAAAATACAGG + Intergenic
1035481835 7:159192953-159192975 CTGAACTTCGTGGAAGGGAAGGG - Intergenic
1035652812 8:1281658-1281680 CTGAATTTCATGAAAAACACTGG - Intergenic
1036800080 8:11784325-11784347 CAGAGCTGCTTGGAAAACACTGG - Intronic
1038419839 8:27426557-27426579 CTGAACATCTTGGGAATGTCTGG - Intronic
1039787715 8:40848450-40848472 CTGAACCTCTTGGAGAAAAGTGG + Intronic
1041714724 8:60922964-60922986 CAGAAGTTCTTTAAAAAGACGGG - Intergenic
1041847431 8:62346794-62346816 CTGAGATTTATGGAAAAGACAGG + Intronic
1044266518 8:90188526-90188548 CTGAAATTCTTGGAAAAAACAGG + Intergenic
1045340361 8:101249120-101249142 CTGAAACACTTGGAAAAAACAGG - Intergenic
1046253411 8:111664810-111664832 TAGAACTACTTGGAAAAGGCCGG + Intergenic
1046506951 8:115148424-115148446 CTGAAATTCTTGTAAAACATAGG + Intergenic
1047745883 8:127844663-127844685 CTGAACTTCTTGGGTAGGAATGG + Intergenic
1049625156 8:143616599-143616621 CTGGACTTCCTGGAGAGGACTGG - Exonic
1050128230 9:2381804-2381826 CGGTACTTCTTGGAAAGTACTGG + Intergenic
1050532494 9:6602785-6602807 CTGAACTTCTTAGGAGACACAGG + Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1060109898 9:120899323-120899345 CTGTACTTTTTAGTAAAGACAGG - Intergenic
1060382643 9:123191129-123191151 GTGAAATGCTTGGAAAAGAGAGG + Intronic
1062213278 9:135376060-135376082 CTGAACTTGCTAGAAGAGACTGG + Intergenic
1190976716 X:55411098-55411120 CAGAGCTTCTTGGTAAAGGCTGG - Intergenic
1192326594 X:70137667-70137689 CTCAACTTCTTACAAAGGACAGG - Intronic
1192593284 X:72379944-72379966 CAGAGCATCTTGGTAAAGACTGG - Intronic
1192670535 X:73135748-73135770 CTGAATTAATTGGACAAGACTGG - Intergenic
1194438827 X:93903512-93903534 CTGAAATTATTGCAAAAGACAGG - Intergenic
1195867630 X:109450315-109450337 CTGCAATTCTTGGAAAAGGAAGG - Intronic
1197284388 X:124578846-124578868 CTGAACTTTTGGGAAAATATTGG - Intronic
1198704175 X:139429606-139429628 CAGAGCCTCTAGGAAAAGACCGG - Intergenic
1199541020 X:148958089-148958111 CTGAACCTCTGTGTAAAGACTGG - Intronic
1200958716 Y:8976068-8976090 GTGAACCTTTTGGAACAGACAGG - Intergenic
1201747324 Y:17391939-17391961 ATGATTTTCTTGGAAAAGGCAGG + Intergenic