ID: 1029710094

View in Genome Browser
Species Human (GRCh38)
Location 7:102294756-102294778
Sequence ACCTGGCTACAGATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029710094_1029710103 7 Left 1029710094 7:102294756-102294778 CCTCTCTCCATCTGTAGCCAGGT 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1029710103 7:102294786-102294808 TCCCTGCTGGCACTGCTGTTTGG No data
1029710094_1029710101 -6 Left 1029710094 7:102294756-102294778 CCTCTCTCCATCTGTAGCCAGGT 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1029710101 7:102294773-102294795 CCAGGTGGGGGCCTCCCTGCTGG 0: 1
1: 0
2: 4
3: 43
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029710094 Original CRISPR ACCTGGCTACAGATGGAGAG AGG (reversed) Intronic
900931568 1:5741299-5741321 ACCTGGCTCCAGGTGGAGCTGGG - Intergenic
901324269 1:8357589-8357611 ACCAGGCTGCAGAGGGAGTGAGG + Intronic
901414383 1:9106579-9106601 CCCTGGGGACAGATGGAGACGGG - Intronic
901918659 1:12519961-12519983 GTCTGGCTGCAGATGGAGACAGG + Intergenic
902202752 1:14845816-14845838 AGCTGGAGACAGCTGGAGAGTGG + Intronic
903445993 1:23423599-23423621 ACATGGCTACGGATGGTGGGAGG + Intronic
904017589 1:27434730-27434752 AACTTGCTACAGATGAAGATGGG - Intronic
907911739 1:58833295-58833317 TTCTGGCCAAAGATGGAGAGAGG - Intergenic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
912384409 1:109264130-109264152 GCCTGGCTCCAGACGGAGAGAGG - Exonic
921320989 1:213938408-213938430 ACTTGGAGACAGATGGATAGTGG - Intergenic
923519447 1:234724737-234724759 CCCTGGCTGCAGACAGAGAGGGG + Intergenic
923558780 1:235022659-235022681 AGCTGGCCACAGAGAGAGAGAGG + Intergenic
923659330 1:235944953-235944975 ACGTGGCTACTGAAGGAAAGAGG + Intergenic
1063460847 10:6214157-6214179 ACCTGGCTGCAGGAGGTGAGTGG + Intronic
1063667126 10:8069463-8069485 TCCTGGCTGCAGACTGAGAGTGG - Exonic
1069838848 10:71326773-71326795 ACCTGCCAGCAGTTGGAGAGAGG - Intronic
1070698248 10:78579044-78579066 ACTTGTCCACAGATGCAGAGAGG - Intergenic
1074586644 10:114774341-114774363 CCCAGGCTACAGGTGGAGGGAGG + Intergenic
1074822788 10:117194024-117194046 GGCTGGATACAGATGGAGGGTGG + Intergenic
1078427778 11:11265594-11265616 ATCTGACAGCAGATGGAGAGGGG + Intergenic
1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG + Intronic
1080853428 11:36091094-36091116 ACCAGGCAACTGAGGGAGAGGGG - Intronic
1081405918 11:42697835-42697857 ACCTGTCTAGAGAAGAAGAGAGG - Intergenic
1084108382 11:66996420-66996442 ACCTAGCTACTGATGGATGGGGG + Intergenic
1085982187 11:81737880-81737902 GCCTGGCTAGAGAGGGAAAGGGG - Intergenic
1089973972 11:122716692-122716714 ACCTGCCTTCAGGTGGAGAAAGG - Intronic
1091665341 12:2414845-2414867 CCCTGGCTTCAGTTGGACAGGGG + Intronic
1097336622 12:58390909-58390931 TACTGACTACACATGGAGAGAGG - Intergenic
1098671018 12:73231618-73231640 ACCTGGCGACATTTTGAGAGTGG + Intergenic
1099004636 12:77221685-77221707 ACAGGGCTAGAGCTGGAGAGAGG - Intergenic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1101984310 12:109433701-109433723 AGGAGTCTACAGATGGAGAGAGG - Intronic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1102248486 12:111369673-111369695 CCCTGGCTCCAGGTGAAGAGAGG + Intergenic
1106553455 13:30790760-30790782 CCCTGGCAGCAGGTGGAGAGTGG + Intergenic
1106622049 13:31379985-31380007 ACCTGGCTACAGTAGGGGAAGGG + Intergenic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1107383986 13:39888536-39888558 ATGTGGCTAGTGATGGAGAGAGG - Intergenic
1108456573 13:50620954-50620976 ACCAGGCTGCAGGAGGAGAGAGG - Intronic
1109077989 13:57862825-57862847 ACATAGCTACAGATGGTGATAGG + Intergenic
1109649673 13:65309856-65309878 ACCTGGCTTCAGAGGCAGGGTGG + Intergenic
1112112840 13:96321770-96321792 GCATGGGTACAGATGCAGAGAGG - Intronic
1112463275 13:99621533-99621555 GCCTGGCAACAGATGGGGTGTGG - Intronic
1113379305 13:109787289-109787311 ACCGCGCTCCAGATCGAGAGCGG + Intergenic
1113794837 13:113050914-113050936 AGCTGGCTGCCGAGGGAGAGAGG + Intronic
1114057391 14:18984123-18984145 AAAGGGCTAAAGATGGAGAGTGG - Intronic
1114082574 14:19214052-19214074 GCCTGGGAACAGATGTAGAGAGG + Intergenic
1114105155 14:19417624-19417646 AAAGGGCTAAAGATGGAGAGTGG + Intronic
1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG + Intronic
1122504181 14:102221212-102221234 GCCTGGGGACAGACGGAGAGGGG - Intronic
1122870996 14:104639026-104639048 CCCTGACCACAGATGGAGAGTGG + Intergenic
1126410580 15:48369181-48369203 ACCTGGCTACAGAGTTAGATAGG + Intergenic
1128767631 15:70260865-70260887 ACCAGGCTACATTTGGGGAGGGG - Intergenic
1129225469 15:74168101-74168123 ACCAGGCTAGAGATGGAGGGAGG - Intergenic
1130734889 15:86537556-86537578 GGCTGGCCAGAGATGGAGAGTGG + Intronic
1130741519 15:86605668-86605690 ACCTGGCTTCAACTGGAGATTGG - Intronic
1131152428 15:90055393-90055415 ACGTGGCTTCACATGGAGGGAGG + Intronic
1131365704 15:91837469-91837491 AGCTGGGGACAGTTGGAGAGGGG - Intergenic
1136029811 16:27494782-27494804 ATCTGGATGAAGATGGAGAGGGG + Exonic
1138760345 16:59535601-59535623 ACCTGGTCAGAGATTGAGAGTGG - Intergenic
1141552514 16:84815623-84815645 GCCTGGCTGCAGAGGGAGACGGG + Intergenic
1141581830 16:85004571-85004593 AGCAGGCTCCAGATGGAGTGGGG - Intronic
1144821131 17:18075484-18075506 AGCTGGATACGGAGGGAGAGAGG + Intergenic
1146061609 17:29610664-29610686 ACCTGGGGACAGATGAAGAAAGG - Exonic
1146684348 17:34830764-34830786 GCCTAGGGACAGATGGAGAGGGG + Intergenic
1146801660 17:35829186-35829208 ACTTGGCTAAAAATGGAGAAAGG - Intronic
1149286186 17:55166939-55166961 ACCTAGCTACTGATGTTGAGTGG - Intergenic
1149972628 17:61234361-61234383 ACCTGGCTCCAGTCAGAGAGAGG - Intronic
1150442818 17:65204692-65204714 ACCTGTCTACTGCTGCAGAGTGG - Intronic
1151404416 17:73877481-73877503 TCCTGGCTACAGCTGGAGCAAGG + Intergenic
1154087951 18:11325682-11325704 ACCTGTCTCCATGTGGAGAGAGG - Intergenic
1156835994 18:41555726-41555748 ACCTTGCAAGAGATGGTGAGGGG - Intergenic
1157201167 18:45661136-45661158 ACATGGCTACAGAAGGCCAGTGG - Intronic
1157280545 18:46344186-46344208 ACCAGCCTGCAGGTGGAGAGGGG + Intronic
1160586074 18:79914436-79914458 ACCTGCCTCCAGATGGGGGGTGG + Intronic
1162469669 19:10864876-10864898 GCCTGGGAGCAGATGGAGAGGGG + Intronic
1163791700 19:19310231-19310253 AGCTGGCTAGAGATGGAGTGAGG + Intronic
1163860640 19:19740992-19741014 ACCAGGATACAGCTGGAGATGGG - Intergenic
1166109748 19:40614665-40614687 ACCGGGCTTCAGCTGCAGAGGGG - Intronic
1167565046 19:50250742-50250764 CACTGGCTACAGATGGGGGGAGG + Intronic
1167679874 19:50912646-50912668 ACTTGGCTCCACATGCAGAGGGG - Intergenic
925298281 2:2792627-2792649 GCCTGGCTGGACATGGAGAGCGG + Intergenic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
927259052 2:21068466-21068488 ACCTAGCTACAGAAGGAGGATGG - Intergenic
927497294 2:23559496-23559518 TCGTGGCTGCAGATGGAGAAGGG + Intronic
927565690 2:24110767-24110789 ACCTGGCTACAGATTTGGGGGGG - Intronic
932079131 2:68695370-68695392 ACCTGGCTGCATCTGGACAGTGG + Intronic
933616418 2:84486485-84486507 ACCTGGATACAGTTGGAGAAAGG + Intergenic
934750289 2:96789486-96789508 ACCTGGCTGCTGCTGGACAGAGG + Intronic
936879531 2:117233098-117233120 ACTTGCATACAGATGGAAAGGGG - Intergenic
937438647 2:121899003-121899025 GCCTGGGCACTGATGGAGAGTGG + Intergenic
938283757 2:130089401-130089423 AAAGGGCTAAAGATGGAGAGTGG + Intronic
938334403 2:130477967-130477989 AAAGGGCTAAAGATGGAGAGTGG + Intronic
938355421 2:130642701-130642723 AAAGGGCTAAAGATGGAGAGTGG - Intronic
938431850 2:131249492-131249514 AAAGGGCTAAAGATGGAGAGTGG - Intronic
938475519 2:131608117-131608139 AAAGGGCTAAAGATGGAGAGTGG - Intergenic
938698495 2:133855682-133855704 TCCTGGCTAGAGATGGCCAGTGG - Intergenic
940604201 2:155899186-155899208 AACTGGCTAAACATTGAGAGTGG + Intergenic
943511129 2:188829269-188829291 AGCTAGCTACAGGTGGGGAGTGG - Intergenic
945973457 2:216252578-216252600 CCCAGGCAATAGATGGAGAGGGG - Intergenic
946378766 2:219330718-219330740 GCCTGGTTAGAGATGGGGAGGGG - Intronic
946771703 2:223095606-223095628 GCCTGGCTATACATGGGGAGAGG + Intronic
947383892 2:229571380-229571402 AGCTGGAGACAGATGGTGAGAGG - Intronic
948427368 2:237896324-237896346 ACCTGGCTGCACATGGAGCCAGG + Intronic
948719558 2:239890077-239890099 AGCTGCCTTCAGATGGATAGAGG + Intergenic
948732150 2:239972950-239972972 GCCTGTCTACTGATGGAAAGTGG - Intronic
1168808158 20:684992-685014 ACCTAGCTGCAGAGGGGGAGGGG + Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1169457821 20:5767886-5767908 AGCTGGCTACAGGAGGAGAAGGG + Intronic
1170356100 20:15493227-15493249 ACCTGGCAACAGATCTAGAAGGG + Intronic
1172304211 20:33870194-33870216 AACTGACAAGAGATGGAGAGAGG + Intergenic
1172948494 20:38706561-38706583 GCCTGGGTACAGATTCAGAGGGG + Intergenic
1174136358 20:48382766-48382788 CACTGGCTGCAGATGGAGAAAGG + Intergenic
1174777611 20:53359808-53359830 GCCAGGCTAAAGATGGTGAGAGG + Intronic
1175376116 20:58525097-58525119 ATCTGGGTCCAGGTGGAGAGAGG - Intergenic
1175816130 20:61884121-61884143 ACCTGGCTGTAGAGTGAGAGGGG + Intronic
1180475880 22:15706732-15706754 AAAGGGCTAAAGATGGAGAGTGG - Intronic
1180859490 22:19069190-19069212 CTCTGGCTGCAGATGGCGAGTGG + Intronic
1181175424 22:21032283-21032305 ACCTGGCCACAGACAGACAGTGG + Intronic
1183284251 22:36952490-36952512 CCCTGGCCACAGATGGGGAGTGG - Intergenic
1184100632 22:42340206-42340228 ACCTGGGAACAGATGGGGACAGG - Intronic
1185142151 22:49108528-49108550 ACCTGTGTGCAGATGGAGGGGGG + Intergenic
949753755 3:7384783-7384805 ACCTGGCTACAGAGAGATTGGGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
954295046 3:49669799-49669821 TCCTGGGGACAGATGCAGAGAGG - Exonic
954806939 3:53226040-53226062 TCATGGCTACAGGTGGAGAAAGG - Intronic
955157763 3:56434119-56434141 ACATGGTTGCAGATGGGGAGAGG - Intronic
957745909 3:84342066-84342088 AACTGGCTACAGATGGTATGAGG + Intergenic
959219165 3:103493846-103493868 ACCCTTTTACAGATGGAGAGTGG - Intergenic
960036123 3:113104805-113104827 GCTGGGCTACAGATGGAGAGGGG + Intergenic
960052025 3:113248163-113248185 GCCTGGCTGCAGAGGGAGTGAGG - Intronic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
960712303 3:120544010-120544032 ACCTACCTACAGATGAAAAGAGG - Intergenic
961122114 3:124381656-124381678 ACCTGACTAAAATTGGAGAGTGG - Intronic
961511085 3:127404153-127404175 CCCTGGTACCAGATGGAGAGGGG - Intergenic
961601886 3:128068601-128068623 ACCACGCTAGAGAGGGAGAGGGG + Intronic
961614005 3:128164507-128164529 CCCTGGCTAAAGAAGGGGAGTGG + Intronic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
963605078 3:147406362-147406384 TCCTGGCAACAGGTGGAGTGGGG - Intronic
964102010 3:152998235-152998257 ACATAGCTACAGAGAGAGAGGGG - Intergenic
964464493 3:156975679-156975701 AGCTGGCTTCATATGAAGAGAGG + Intronic
965491785 3:169346248-169346270 ACCTGGCTGCAGTCTGAGAGAGG - Intronic
965631166 3:170734392-170734414 CCCAAGCTACAGAGGGAGAGAGG - Intronic
966240014 3:177745473-177745495 ACAAGGCTGGAGATGGAGAGAGG - Intergenic
966916026 3:184584423-184584445 ACCTGGATACAGGAGGAGCGAGG - Intronic
968631868 4:1656057-1656079 GCCTGGTCACAGAGGGAGAGGGG - Intronic
969060210 4:4428141-4428163 ACCTGGCAACAGACGAAGGGAGG - Intronic
971957914 4:33446326-33446348 GCCTGGCTTAAGATGGACAGAGG - Intergenic
972714621 4:41633181-41633203 ACCTGGCGACTGATAGAGCGTGG + Intronic
973745175 4:53956968-53956990 ACCTGCCTTCAGATACAGAGAGG + Intronic
973883080 4:55293188-55293210 ACCTGGTGAAGGATGGAGAGGGG + Intergenic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
979059794 4:116043486-116043508 TCCTGGTTACAGATGAAGATCGG + Intergenic
981497636 4:145411759-145411781 ACCTGGCTATATTTGGAGATAGG + Intergenic
982244267 4:153334253-153334275 ACCTGGAAATAGATGGGGAGAGG + Intronic
983430329 4:167641906-167641928 AGCTGACTCCTGATGGAGAGGGG - Intergenic
984949248 4:184994518-184994540 ACCTAGGTTCAGATGCAGAGAGG - Intergenic
985267116 4:188160573-188160595 CCCTGGCTCCAGAAGCAGAGAGG - Intergenic
986225982 5:5813158-5813180 AGCTGGCCAAAGATGCAGAGGGG - Intergenic
986826574 5:11528850-11528872 ACCTGGCCACTGATGAAAAGGGG - Intronic
993459199 5:88162181-88162203 GCCTGCTTACAGGTGGAGAGTGG - Intergenic
997359637 5:133286640-133286662 ACCTTGCTTCAGATGCATAGTGG - Intronic
998004577 5:138648637-138648659 TCCTGCCCAGAGATGGAGAGGGG - Intronic
998815873 5:146013659-146013681 ACCTGGCTTCAGATGTACATGGG + Intronic
999639538 5:153658331-153658353 ACTTGGCAACAGATGGAGGCTGG - Intronic
1000442147 5:161276791-161276813 ACCTGTTTACAGATGAGGAGAGG + Intergenic
1001332739 5:170773584-170773606 ACCTGGCTTCAGGTGGGGATTGG - Intronic
1003410374 6:5856651-5856673 ACATGTCTACAGATGGGCAGGGG + Intergenic
1004576777 6:16903659-16903681 ATCTGGCAGCGGATGGAGAGGGG + Intergenic
1006562261 6:34923763-34923785 TCCTGAATTCAGATGGAGAGAGG + Intronic
1006899022 6:37488200-37488222 ACCTGGCTGCAGAGGCAGGGAGG + Intronic
1011014853 6:82743601-82743623 CCCTGTCTACAAATGGGGAGGGG + Intergenic
1013927305 6:115488610-115488632 AGCTGACTACAGCTGGATAGAGG - Intergenic
1015936757 6:138412329-138412351 ACCTGTCAACAGATGGAAGGAGG + Intronic
1016770290 6:147841895-147841917 ACATGGCTCCAGATGGAGGCTGG + Intergenic
1017806026 6:157946238-157946260 AGCTTGCTACAGATGCAGTGTGG - Intergenic
1018891939 6:167989040-167989062 CCCTGGCCAAAGATGGAGACTGG - Intergenic
1019562841 7:1666711-1666733 ACCAGGTTTCAGATGAAGAGGGG - Intergenic
1021763611 7:23925283-23925305 ACCTGGCTAAAAATGGCGTGTGG + Intergenic
1022787305 7:33651290-33651312 ATTTGACTACCGATGGAGAGAGG - Intergenic
1023014603 7:35954916-35954938 GCCTGGCGACAGAGGGACAGAGG + Intergenic
1023270414 7:38456129-38456151 ACCAGGCCAAAGAGGGAGAGGGG + Intronic
1023404717 7:39820732-39820754 ACCTGGATAAAGCTTGAGAGTGG + Intergenic
1023628964 7:42144198-42144220 ACCTGGCTACAGACAGAGCATGG + Intronic
1025928054 7:65974794-65974816 AAATGGCTCCAAATGGAGAGGGG - Intronic
1027128389 7:75573336-75573358 ACCTGCCTACAGACAGAGAGCGG + Intronic
1028549422 7:92042068-92042090 ACCTGGTTTCAGAGAGAGAGAGG + Exonic
1029225801 7:99027789-99027811 ACCTGGCTGCAGATGGCGGGTGG + Exonic
1029352984 7:100028633-100028655 ACTTGGCAAGAGATGGGGAGGGG + Intronic
1029484302 7:100829696-100829718 ATCTGGGTACAGAGTGAGAGTGG - Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1038612957 8:29071123-29071145 GCCTGGGTCCAGATGGAGAAGGG - Intronic
1038840260 8:31177937-31177959 ACCTGGAAAAGGATGGAGAGGGG - Intergenic
1039333643 8:36566445-36566467 ATCTAGCTACAAATGGAGAGGGG + Intergenic
1039517228 8:38144278-38144300 ACCTGGCTTCAGAGGCAGGGTGG + Exonic
1039721244 8:40167000-40167022 TCCTGGCAAAAGATGGAGAAAGG + Intergenic
1039919418 8:41882792-41882814 CCCTGACTCCAGAGGGAGAGGGG - Intronic
1041529409 8:58846930-58846952 ACCTTGTTACAAATGCAGAGTGG + Intronic
1041839104 8:62248756-62248778 AGGAGGCTACAGATGGCGAGTGG - Intronic
1042166794 8:65953390-65953412 ACCTGGCTCCCTAAGGAGAGTGG + Intergenic
1042701945 8:71625158-71625180 ACCTGGCTACAGGAGGAGCTGGG - Intergenic
1042728510 8:71904499-71904521 ACCTGGGTAGAGATGGGGAGAGG + Intronic
1042879674 8:73473195-73473217 ACCCGGCTTCAGATGGGCAGTGG + Intronic
1044845261 8:96373929-96373951 CCCTGGCTGCAGATTGGGAGGGG + Intergenic
1047712213 8:127563902-127563924 ACCTGGAAACTGAGGGAGAGAGG + Intergenic
1048050574 8:130812182-130812204 AATTGGCTACTGATAGAGAGTGG - Intronic
1051074925 9:13222256-13222278 TGCTGGCTGCAGATGGAGAACGG + Exonic
1054938334 9:70712990-70713012 ACCTGGTTCCAGTGGGAGAGAGG - Intronic
1054940025 9:70730983-70731005 ACCTGGTTCCAGTGGGAGAGAGG - Intronic
1055379606 9:75691541-75691563 ACCAGGAGACAGATGGAGGGAGG - Intergenic
1055994087 9:82138838-82138860 GCCTGGCTGAAGATGGAGAGTGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1059334048 9:113557530-113557552 ACCTGGCTTGAGAATGAGAGAGG + Intronic
1060156626 9:121324830-121324852 CCATGGCTACAGATGCAGTGTGG - Intronic
1060190475 9:121589172-121589194 ACATGGATCCACATGGAGAGGGG + Intronic
1061649016 9:132031150-132031172 ACCTGGCTTCTGATGGAGCAGGG - Intronic
1062536563 9:137023685-137023707 AGCTGGCTCCAGATGGGGGGTGG - Intronic
1187430045 X:19214285-19214307 ACCTGTCTACACAGGGTGAGAGG - Intergenic
1187598574 X:20801551-20801573 ACCATGCTAAAGATGGAGAGAGG - Intergenic
1192493549 X:71597554-71597576 AGAGGGCCACAGATGGAGAGAGG - Intronic
1193355234 X:80512605-80512627 GCTTGGGTACAGAAGGAGAGGGG - Intergenic
1195677365 X:107517268-107517290 ACATGGGTACAGATGTAGACAGG + Intergenic
1196943464 X:120800667-120800689 TACTGGCTACAGTTAGAGAGAGG + Intergenic
1199494025 X:148433103-148433125 ATCTGGCCAGAGATGGAGAGTGG - Intergenic
1200210690 X:154345509-154345531 CCCTGGTTGCAGTTGGAGAGTGG + Intergenic
1200220162 X:154386583-154386605 CCCTGGTTGCAGTTGGAGAGTGG - Intergenic
1201905731 Y:19084170-19084192 AGCTGGGTACAGAGGGACAGTGG - Intergenic
1201982805 Y:19925671-19925693 AAGTAGCTCCAGATGGAGAGTGG + Intergenic