ID: 1029711706

View in Genome Browser
Species Human (GRCh38)
Location 7:102303509-102303531
Sequence TCCAGGGCCCATGTGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029711706_1029711714 28 Left 1029711706 7:102303509-102303531 CCATGAGCCACATGGGCCCTGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1029711714 7:102303560-102303582 CTCTGAAGAGCTTTTTCCCCAGG No data
1029711706_1029711711 -6 Left 1029711706 7:102303509-102303531 CCATGAGCCACATGGGCCCTGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1029711711 7:102303526-102303548 CCTGGAAAAGTGACTTCCCAGGG 0: 1
1: 1
2: 2
3: 24
4: 318
1029711706_1029711709 -7 Left 1029711706 7:102303509-102303531 CCATGAGCCACATGGGCCCTGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1029711709 7:102303525-102303547 CCCTGGAAAAGTGACTTCCCAGG 0: 1
1: 1
2: 2
3: 25
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029711706 Original CRISPR TCCAGGGCCCATGTGGCTCA TGG (reversed) Intronic
900144280 1:1151139-1151161 CCCAGGGCCCATGGTGCTGAGGG + Intergenic
900539616 1:3196309-3196331 TCCAGGGCCCGGCTGGGTCAGGG - Intronic
900604377 1:3517237-3517259 TCCTGGGCCCTTGTGGCGCCTGG - Intronic
900674572 1:3876894-3876916 CCCAGAGCCCATGCGGTTCAGGG + Intronic
902667703 1:17951216-17951238 TCAAGGGACCGTGTGGCCCAAGG - Intergenic
903219364 1:21860271-21860293 TCAAGGGCCCCAGTGCCTCATGG + Intronic
903809021 1:26024305-26024327 TCCAGGGCCCCGGTGGCAGAGGG + Intronic
904714434 1:32456670-32456692 TCCAGGGACCCTGTGGCTTCTGG - Intergenic
905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG + Intergenic
906236327 1:44213538-44213560 GCGAGGGCCCAGGTGGCTGAAGG + Exonic
907267757 1:53273040-53273062 TCCAGGGCTCAGGTGGGTGAGGG + Intronic
907641851 1:56198532-56198554 TCCAGAGCCCATGTGGTGCTTGG + Intergenic
908424063 1:63988194-63988216 TCCAGGACCCAGCTGTCTCAGGG + Intronic
912856211 1:113170787-113170809 CTCAGGGCCCCTGTGGGTCAGGG - Intergenic
914245092 1:145879605-145879627 TCCAGGGTCCTTCTGGCTCAGGG - Intronic
915564302 1:156705342-156705364 TCGAGGGCCCAGGTGGGGCAAGG - Intronic
916194308 1:162209251-162209273 TGTAGGGCCCAAGTGTCTCAGGG + Intronic
916430628 1:164724549-164724571 TCTGGGCCGCATGTGGCTCATGG + Intronic
920524341 1:206655721-206655743 GCCAGGGCAATTGTGGCTCAGGG - Intronic
920873848 1:209816343-209816365 TCCATGGCTCTTGTGGCTTAAGG - Intergenic
922173902 1:223179880-223179902 TTCAGAGCACATGTGGCCCAAGG + Intergenic
923046269 1:230357689-230357711 TCCAGAACCCGTGTGGCACAGGG + Intronic
923103071 1:230832708-230832730 GCCAGGGCCCATGTGGTTTCCGG + Intergenic
924887894 1:248239599-248239621 CCCAGAGCCCATGTGGATGACGG - Exonic
1062947437 10:1472314-1472336 ACCAAGGGCCATGCGGCTCAGGG + Intronic
1063355838 10:5397607-5397629 TCCCGGGCACAGGTTGCTCAGGG + Intronic
1064113967 10:12561941-12561963 TCCAGGGTCCATGTATCTCTGGG + Intronic
1064506274 10:16033823-16033845 TCCTTGGCACATGTGGGTCATGG - Intergenic
1065599086 10:27350211-27350233 CCCAGGAGCCATGTGGCGCAAGG + Intergenic
1065978385 10:30864336-30864358 TCCAGGCCCCTTGTGCCTCGGGG + Intronic
1067431722 10:46249817-46249839 TCCAGGGCCCATCTTGCTGAGGG - Intergenic
1067441698 10:46312357-46312379 TCCAGGGCCCATCTTGCTGAGGG + Intronic
1069611212 10:69773892-69773914 CTCAGGGCCCATGTGGCTCCTGG - Intergenic
1070692422 10:78537016-78537038 GCCAGGGCTCATTTTGCTCATGG - Intergenic
1072732280 10:97854316-97854338 TCCCAGGGCCATGTGGCCCAGGG + Intronic
1076466588 10:130686831-130686853 TCCTGGGCCCATGCGGATTATGG + Intergenic
1076497135 10:130904624-130904646 GCCAGGGCCCATCTGGTGCAGGG + Intergenic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1077217806 11:1402323-1402345 TTCAGGGCTCATGTGGCCTAAGG + Intronic
1077675672 11:4191502-4191524 TCCAGGGCCCTGCAGGCTCAAGG - Intergenic
1079116047 11:17641157-17641179 TCAAGGGCCCCTCTGGCTCCTGG - Intronic
1081998370 11:47378477-47378499 CCCAGGGCTCCTGTAGCTCAGGG - Intronic
1083935404 11:65867338-65867360 TCAAGGCCACATGTGGCTCTTGG + Intronic
1085875115 11:80397446-80397468 ACCAGGGCTCAGATGGCTCAAGG - Intergenic
1088648388 11:111936731-111936753 TCCAGGGCCCATGTGGAAAAAGG + Intronic
1088699122 11:112396413-112396435 TCCAGGGACCAGGAGGCTCTTGG - Intergenic
1089136542 11:116253727-116253749 TCCTGGACCCAGGTGCCTCAGGG - Intergenic
1089591205 11:119541862-119541884 TTCAGGGCCCAAGTGCCTCCAGG + Intergenic
1089726924 11:120489648-120489670 TCAAGGGCACATTTGGCTGACGG + Exonic
1091408187 12:221743-221765 TCCAGGGCCCCTGTGCCCCTGGG + Intronic
1095261262 12:40102523-40102545 TATACGGCCCATGTGGGTCAAGG - Intronic
1096225970 12:49867228-49867250 CCGAGGGCCCATGTGGCTGGAGG - Exonic
1098061664 12:66569613-66569635 ACCAGGGACCATGGGACTCAGGG + Intronic
1099980487 12:89595947-89595969 TTCTGGGCCCATGTGGCTAGGGG - Intronic
1103006704 12:117426680-117426702 TCCAGGGCCTGGGAGGCTCAAGG + Intronic
1103602616 12:122063833-122063855 AACAGGGCCCATGTGGCCCCAGG + Intergenic
1105063117 12:133172296-133172318 TCCAGGGCTCAGGAGGATCAAGG - Intronic
1106718404 13:32415137-32415159 TCCTGGGTCCATGTTGATCATGG - Intronic
1107541562 13:41393896-41393918 AGCAGGGCCCATGTGCCTCAGGG + Intergenic
1112422584 13:99266440-99266462 TCCTGGGCCCATGTGGCCCATGG + Intronic
1112509676 13:99998002-99998024 CCCAGGGCCCCTGTGGGTCCCGG + Intergenic
1113496076 13:110730360-110730382 TCCAGGGTTCATGTGGCTTCAGG - Intergenic
1117401119 14:55359027-55359049 TCCAGGCCCTTTGAGGCTCAAGG - Intronic
1119237642 14:73033035-73033057 TCCAAGGAAAATGTGGCTCATGG - Intergenic
1119327834 14:73772054-73772076 TCCAGCCCCCAGCTGGCTCAGGG - Intronic
1119987233 14:79151520-79151542 TCCAAGGACCATGTGGATCATGG - Intronic
1121950999 14:98171180-98171202 ACAAGGGACCCTGTGGCTCATGG - Intergenic
1122287756 14:100662032-100662054 TTCAGTACCCATGTGGCTCATGG - Intergenic
1122389619 14:101371256-101371278 TCCAGGGCTGATGTACCTCATGG - Intergenic
1122539836 14:102491977-102491999 GGCAGGGCTCATGTGGCCCAAGG - Intronic
1124658245 15:31525541-31525563 TGCAGGGCCCATGAGCCTGAGGG + Intronic
1124701169 15:31913662-31913684 TCCAACCCCCATGTTGCTCAAGG + Intergenic
1125812092 15:42550156-42550178 TCCAGGACCCATGTGGTCCGCGG - Intronic
1129251060 15:74309188-74309210 CCCAGGGCCCATCAGGCTGAGGG - Intronic
1129770273 15:78199016-78199038 TCCAAGGGCCATGTGTCTAAAGG - Intronic
1129895125 15:79099511-79099533 TCCAGTGTCCCTGAGGCTCAAGG + Intergenic
1130162921 15:81419594-81419616 TCCCGATGCCATGTGGCTCAGGG + Intergenic
1132598170 16:762584-762606 TCCTGGGCCCATGTGGCCCCAGG + Intronic
1132708570 16:1256686-1256708 TCCAGGCCCCAGGAGACTCACGG - Exonic
1132860969 16:2071632-2071654 CCCACGGCCCATGAGGCTCAGGG + Intronic
1133673551 16:8047700-8047722 TCTAGGGCCCTTCTGGCTCAGGG + Intergenic
1134856983 16:17528151-17528173 TCCAAGGCCCACATGGCCCACGG + Intergenic
1136660907 16:31761016-31761038 TCAAGGGCCCATGGAGTTCATGG + Exonic
1137791949 16:51182543-51182565 TCCAGGGACCATGGGAGTCAGGG - Intergenic
1138145840 16:54611227-54611249 TCCAGTTCCCATGTGGTCCAGGG + Intergenic
1140349902 16:74252277-74252299 AACAGGCCCCTTGTGGCTCAGGG + Intergenic
1141466629 16:84210202-84210224 TTCAGACCCCAGGTGGCTCAGGG - Intergenic
1142112825 16:88341296-88341318 TCCAGGGCCCAGGAGGCGCATGG + Intergenic
1142354354 16:89595306-89595328 TGCAGGGCGCATGTGGGCCATGG + Intronic
1142805764 17:2370330-2370352 TCCACGGCCCACGTGGGGCAGGG - Intronic
1142943353 17:3402384-3402406 TGCAGGGTCCCTGAGGCTCAGGG - Intergenic
1147048523 17:37772930-37772952 CCCAGGCCACATGTGGCCCATGG + Intergenic
1147156050 17:38544926-38544948 GCCTGTGCCCATGTTGCTCAGGG + Intronic
1148131660 17:45266006-45266028 TCCAGGGCAAGTGTGACTCATGG - Intronic
1148392580 17:47283469-47283491 TCCAGAGCCCTTGTCGCTGAGGG - Exonic
1148905246 17:50907834-50907856 ACCAGGGCCCTCATGGCTCATGG + Intergenic
1148952290 17:51323895-51323917 TACTGGTCCCATGTGCCTCATGG - Intergenic
1152672461 17:81617200-81617222 CACAGGGGCCATGTGGCTCCTGG - Intronic
1152922915 17:83074657-83074679 TGCAGCTCCCACGTGGCTCAGGG + Intergenic
1153971721 18:10233378-10233400 CCCAGGGGCCATCTGCCTCATGG + Intergenic
1153996325 18:10444978-10445000 TCCAGGTCTCTTCTGGCTCAGGG + Intergenic
1155300736 18:24426745-24426767 TCCAGGGGCCACATGGCTGAGGG + Exonic
1157298406 18:46462282-46462304 TCCAGGTCCCAGCCGGCTCAGGG - Exonic
1157451018 18:47789203-47789225 GCCACAGCCCATCTGGCTCAAGG - Intergenic
1158655595 18:59328703-59328725 TCCATGGACCATCTGGGTCATGG - Exonic
1160122516 18:76143474-76143496 TGCAGGGCCAATGTGGCAGAAGG + Intergenic
1160692000 19:464431-464453 TCCAGGGTGCATGTGGGCCATGG - Intronic
1160802179 19:975168-975190 TCCAGGGTCCTCGTGGCTGAGGG - Exonic
1160852548 19:1199870-1199892 TCCAGGTCCCTGGTGGCTCTGGG - Intronic
1161467055 19:4436872-4436894 TGCTGGGCACATGGGGCTCAGGG - Intronic
1161506877 19:4648779-4648801 TCCAGGGCCGATGGGGTCCAGGG + Intronic
1161943203 19:7418742-7418764 GCCCCGGCCCATGTGGCTGATGG + Intronic
1162216679 19:9140433-9140455 TCCTTGGCCCATGTGTCTCGGGG - Exonic
1163020490 19:14478605-14478627 ACCAGGGACCAAGGGGCTCAGGG + Intronic
1163397222 19:17070683-17070705 TCCTGGGCCCCTGGGGCTCTAGG - Intronic
1163626908 19:18395504-18395526 CCCAGGTCCCATGTGACCCAAGG - Intronic
1163986791 19:20961251-20961273 TTCAAGGCCCATGGGGTTCAGGG + Intergenic
1164624554 19:29717516-29717538 CCTTGGGCCCATGAGGCTCATGG - Intergenic
1164655416 19:29917617-29917639 AGCAGGGGCCATGTGGGTCACGG + Intergenic
1165236873 19:34428641-34428663 TCCAGGGGCTCTGAGGCTCAGGG + Intronic
1165624170 19:37270886-37270908 CACAGGGCCCATGTGTCCCAAGG + Intergenic
1165624716 19:37273427-37273449 CACAGGGCCCATGTGTCCCAAGG + Intergenic
1165626871 19:37283546-37283568 CACAGGGCCCATGTGTCCCAAGG + Intergenic
1165627414 19:37286065-37286087 TACAGGGCACATGTGTCCCAAGG + Intergenic
1165629030 19:37293644-37293666 CACAGGGCCCATGTGTCCCAAGG + Intergenic
1165630116 19:37298693-37298715 TACAGGGCACATGTGTCCCAAGG + Intergenic
1166863094 19:45820982-45821004 TCCAGGGCACTTGTGGGCCAGGG - Intronic
1168553631 19:57320489-57320511 TCCAGGGCCAATCCTGCTCACGG - Exonic
925238927 2:2304894-2304916 TCAAGAGCCCATGTGGCTAGTGG - Intronic
925404418 2:3596738-3596760 GCCAGGGCCCAAGACGCTCAGGG - Intronic
926551007 2:14300657-14300679 TTGAGGGCCCAGGTGGCTCTGGG - Intergenic
926750865 2:16197554-16197576 TCCAGGCCGCATCTGGCTCTGGG + Intergenic
927849013 2:26487311-26487333 TCCAGGACCCATGTGACTTCAGG + Intronic
928028492 2:27758983-27759005 GCCAGGCACCGTGTGGCTCATGG + Intergenic
928082567 2:28323925-28323947 TCACGGGCCCATGTGGTTCTTGG - Intronic
929346437 2:40890139-40890161 CCCAGGGCCCCTGTGGGTTAAGG - Intergenic
929454251 2:42055029-42055051 TCCAGGGCCCATCTGCTTCCAGG + Intronic
933992994 2:87647067-87647089 TCCAGGGACCCTGTGGCTCTGGG - Intergenic
934555304 2:95284057-95284079 TCCAGTGCCCATCTGGCTTCTGG - Intronic
936300862 2:111303812-111303834 TCCAGGGACCCTGTGGCTCTGGG + Intergenic
936624608 2:114135338-114135360 TCCATGGCCCATGGGACTGATGG + Intergenic
938069606 2:128301347-128301369 CCCAGGGGCCATGTGGCTCCAGG + Intronic
941351158 2:164438658-164438680 TCCAGGGCACATGGGGATTATGG - Intergenic
946883136 2:224196036-224196058 TCCAGGGCCCCTGTCTTTCAGGG - Intergenic
947455509 2:230250431-230250453 TACAGGGGAAATGTGGCTCAAGG - Intronic
947670786 2:231934180-231934202 TGCTGAGCCCATGTGGCTGAGGG - Intergenic
948310430 2:236981690-236981712 TGCAGTGCCCATGTGGCCCCAGG + Intergenic
948763689 2:240208715-240208737 TCCAGCCCCCATGTGCCTCCTGG + Intergenic
948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG + Intronic
949034912 2:241811890-241811912 GCCAGGGCCCAGGACGCTCACGG + Intronic
1169070956 20:2730067-2730089 TCCAGGTGCCCTGTGGCTGAGGG + Intronic
1169640432 20:7744752-7744774 TCCAGGGTCCATGTGATTCCAGG + Intergenic
1170560908 20:17557498-17557520 TCCTGGGCCCTCCTGGCTCAAGG + Intronic
1172126279 20:32627035-32627057 GCCAGGGCCCATGTGGCAAGGGG - Intergenic
1173109578 20:40174173-40174195 TTAAGGGCCCAGGTGGCTTAAGG - Intergenic
1173972817 20:47165667-47165689 GCCTGGGCCCATGTGTGTCAAGG + Intronic
1174714078 20:52738038-52738060 TCCTGGGTCCAGGTGGCTCGGGG + Intergenic
1174878024 20:54248615-54248637 TCCAGGTCCCATGTGGGCCCTGG - Intergenic
1175785739 20:61710656-61710678 GCAAGGGCCCATGTGGAGCAGGG + Intronic
1175816698 20:61886791-61886813 CCAAGGGCCCGTGTGGCACAGGG - Intronic
1176004697 20:62854388-62854410 TCCAGGGAGCTTGTGGGTCATGG - Intronic
1176179645 20:63743240-63743262 CCCAGGGCCCTTGGGGCTAAGGG - Exonic
1176428448 21:6562543-6562565 TCCCGAGCTAATGTGGCTCAGGG + Intergenic
1176706586 21:10123056-10123078 GCCAGGGTCCATGGGGCCCAGGG - Intergenic
1179703938 21:43170859-43170881 TCCCGAGCTAATGTGGCTCAGGG + Intronic
1179973032 21:44846898-44846920 GCCAAAGTCCATGTGGCTCACGG + Intergenic
1180051430 21:45333257-45333279 TCCAGGGGCCCTGTGGTGCATGG + Intergenic
1180800644 22:18630385-18630407 TGGAGGGGCCATGTGGGTCACGG - Intergenic
1180851876 22:19025942-19025964 TGGAGGGGCCATGTGGGTCACGG - Intergenic
1181221075 22:21364877-21364899 TGGAGGGGCCATGTGGGTCACGG + Intergenic
1181534831 22:23536024-23536046 TCCTGGGCCCCTGTGGGACAAGG + Intergenic
1181711996 22:24696726-24696748 GCCAGGGCCCCTGAGGCCCAGGG + Intergenic
1182282481 22:29225432-29225454 TCCAGGGGTCATGGGTCTCAGGG - Intronic
1183814727 22:40290170-40290192 TCAAGGGCTGATGTGGCTGACGG - Intronic
1184822296 22:46918387-46918409 TCCAGGTCCCCTGTGGCTGGTGG - Intronic
1185205253 22:49534142-49534164 TCCATGGTCCCTGCGGCTCAGGG - Intronic
950014043 3:9743783-9743805 TCGAGGGGCCATGCCGCTCAGGG - Exonic
950143723 3:10633086-10633108 TCCCAGGCCCACATGGCTCAGGG - Intronic
951652433 3:24965521-24965543 CCCGGAGCCCATGTGCCTCATGG - Intergenic
952536062 3:34310259-34310281 TCCAGGGCCCGGGAGGCTCTGGG + Intergenic
953404852 3:42655030-42655052 TCCAGCGCCCACGTGGCCCAAGG - Intronic
955623293 3:60889271-60889293 AGCAGGGGCCATGTGCCTCAGGG + Intronic
960551097 3:118977312-118977334 TGCAGGGCCCTTGTGGCTAAGGG + Intronic
960619305 3:119623554-119623576 TCCAGTGTCCATGCTGCTCAAGG + Intronic
960856312 3:122105840-122105862 TCTAGGGCCCAGGTGTCCCATGG - Intronic
961269860 3:125680571-125680593 ACCAGGGGCCATCAGGCTCAAGG + Intergenic
961476624 3:127150879-127150901 TCCAGGGCACAGGTGGTTCTTGG - Intergenic
961765257 3:129205524-129205546 TCCACAGCCCATGTGGCTGCAGG - Intergenic
967877198 3:194275601-194275623 TCCAGGGACCCTGGGGCTGAAGG + Intergenic
969259915 4:6026781-6026803 CACAGGCCCCATGTGGCCCACGG + Intronic
969297026 4:6276238-6276260 TCCAGGGCCCATCCGGGTCCGGG + Intronic
969325449 4:6441408-6441430 TGGAGGCCCCATGGGGCTCATGG - Intronic
969889759 4:10249121-10249143 TCCAGGACACCTCTGGCTCATGG - Intergenic
970171089 4:13291122-13291144 TCCTGGCCCCAAGTGGCTCCTGG - Intergenic
970534548 4:17016742-17016764 TGCCAGGCCCATGTGGCTCAAGG - Intergenic
975605486 4:76150004-76150026 CACAGGCCACATGTGGCTCATGG + Intergenic
981413125 4:144456465-144456487 CCCAGGGCTCATGTGGCTGGTGG + Intergenic
982091460 4:151883503-151883525 TCCAGGGCTGAGGTGGATCAGGG + Intergenic
982191071 4:152855746-152855768 TTCAGGGCCCATGAGGGTCCAGG + Intronic
987496631 5:18653257-18653279 TCCCAGGCCCAGGTAGCTCATGG - Intergenic
993110028 5:83645365-83645387 TCTGGGCCACATGTGGCTCATGG - Intronic
994201869 5:96985813-96985835 TCCTGGACCCATGTGGCTAAGGG + Intronic
994558103 5:101330720-101330742 TCAAGTGCCCATGGGGGTCATGG - Intergenic
995788400 5:115856545-115856567 TCCAGGGCTCAAGGGCCTCAAGG + Intronic
995800242 5:115985912-115985934 TCCTGGGCCCAAGGGGCCCAAGG + Intronic
995856418 5:116597550-116597572 TCCACGTCCCAGGTGGGTCAAGG - Intergenic
996554861 5:124768038-124768060 ACCAGGGCCCATGTTGATGAAGG + Intergenic
996663042 5:126026953-126026975 TCCAGGCCCCAGATGGCTCCAGG + Intergenic
998254376 5:140573574-140573596 CCCAGGGCCTATGTGGCACTGGG + Intronic
1002482981 5:179515664-179515686 TCCAGGGCACATGAGCCACACGG + Intergenic
1002847585 6:961688-961710 GCCACGGTCCATGTGGCTCCTGG - Intergenic
1004343896 6:14830836-14830858 TGCAGGGCCCACGCAGCTCAGGG - Intergenic
1006598538 6:35211091-35211113 GCCAGGGCCCACCAGGCTCAGGG - Intergenic
1007943517 6:45804304-45804326 TGAAGGGCCAATGTGGCTCCAGG - Intergenic
1015231170 6:130916585-130916607 TAGTGGGCCCATGTGGTTCATGG - Intronic
1017007139 6:150036234-150036256 TCCAGGGTCCAAGTGGGTCTTGG + Intergenic
1017643590 6:156517848-156517870 TCCAGCGCCCATCAGCCTCATGG + Intergenic
1018091105 6:160347830-160347852 TCCTGCGCCCATGTGGGGCAGGG - Intergenic
1019168465 6:170115137-170115159 ACCAGGGCCCAGGTGACTCCAGG + Intergenic
1019275539 7:173641-173663 TCCAGGGGCCATGGGGCCCGGGG + Intergenic
1019924976 7:4185974-4185996 TCCAGGGCCCAGGGAGCTCAGGG + Intronic
1020655999 7:10928558-10928580 AGCAGGGTCCATGTGCCTCAGGG + Intergenic
1022326938 7:29341046-29341068 ACCGAGGCCCATGTGGGTCAAGG + Intronic
1023058726 7:36309966-36309988 TGCAGGGCCCAGGGGGCTCTCGG - Intergenic
1023302666 7:38790728-38790750 TCCAGGACCCCTGTGGATCCTGG - Intronic
1024180268 7:46885960-46885982 TTCAAGGAACATGTGGCTCAAGG + Intergenic
1027220478 7:76210783-76210805 TCCAGGGCTGCTGGGGCTCAAGG - Intronic
1029373995 7:100167084-100167106 GAGAGGGCCCATGTGGCACAGGG + Exonic
1029520236 7:101056242-101056264 TTCAGGGTCTATGTGTCTCAAGG - Exonic
1029711706 7:102303509-102303531 TCCAGGGCCCATGTGGCTCATGG - Intronic
1029882982 7:103836395-103836417 TCAATAGCACATGTGGCTCATGG + Intronic
1030114097 7:106050169-106050191 GCCAGGCCCCAGCTGGCTCATGG - Intergenic
1030681575 7:112439858-112439880 TCGAGGGGCCATGTGCTTCAGGG - Intronic
1033460719 7:141545155-141545177 TGCAGGGCCCATATAGATCATGG + Intergenic
1034275174 7:149820863-149820885 TCCAGGGACCCTGTGGGGCAAGG - Intergenic
1034946926 7:155268341-155268363 TGCAGGGCCCAGGAGGCTCCCGG - Intergenic
1035328543 7:158081482-158081504 TCCAAGGCCGCTGTGGCTCCAGG + Intronic
1035403606 7:158584959-158584981 TCCAGAACACATGTGGTTCAAGG - Intronic
1037370362 8:18170750-18170772 TCCAGGGCCCATTGAGCCCAGGG + Intronic
1037649813 8:20826086-20826108 TCCAGAGCCTATGAGGCCCAAGG + Intergenic
1038335775 8:26644147-26644169 TCTGGGGGCCATGGGGCTCATGG + Intronic
1042086989 8:65120365-65120387 AGCAGGGGCCATGTGGGTCAGGG - Intergenic
1046118003 8:109807608-109807630 TCCAGGGCCCATGAGAATAATGG + Intergenic
1046497553 8:115034868-115034890 TCCAAGGCCTTTGTGCCTCAAGG + Intergenic
1047252812 8:123193347-123193369 GCCAGGCCACCTGTGGCTCATGG + Intronic
1049004841 8:139847963-139847985 TCCAGGCCCCACGTGCCCCAGGG - Intronic
1049426115 8:142538609-142538631 TCCAGGGGCCCTGGGGCTCCAGG - Intronic
1049604510 8:143523038-143523060 TCCAGGGCCCCTCAGGGTCAGGG + Intronic
1049607775 8:143537621-143537643 TCCAGGGTCCATGTGTCCCCAGG - Intronic
1049733655 8:144192079-144192101 TCCATGGCACCTGTGGCTTAGGG + Intronic
1049829707 8:144692603-144692625 TACAGGGACTGTGTGGCTCAGGG + Intergenic
1051604910 9:18909276-18909298 TCCAGGCTGCATGAGGCTCATGG + Exonic
1051860539 9:21620390-21620412 TCAATAGCACATGTGGCTCATGG - Intergenic
1051940270 9:22496561-22496583 TCCAGGGCCCTGGTGGCCTAGGG + Intergenic
1052823072 9:33154763-33154785 TCCTGGCCGCATGTGGCCCATGG - Intronic
1053286840 9:36855204-36855226 TCCTGGCCCCATGTGTCTCGAGG - Intronic
1053593004 9:39533235-39533257 TCCAGGGTCCTCGTGGCTGAGGG + Intergenic
1053643879 9:40110175-40110197 GCCAGGGTCCATGGGGCCCAGGG - Intergenic
1053762273 9:41355314-41355336 GCCAGGGTCCATGGGGCCCAGGG + Intergenic
1053850742 9:42287943-42287965 TCCAGGGTCCTCGTGGCTGAGGG + Intergenic
1054324734 9:63707403-63707425 GCCAGGGTCCATGGGGCCCAGGG - Intergenic
1054573302 9:66832042-66832064 TCCAGGGTCCTCGTGGCTGAGGG - Intergenic
1054730074 9:68692682-68692704 TCAAGTGCACATGTGGCTCGTGG + Intergenic
1054850386 9:69841594-69841616 TACAGGTCCCATCTGGCTCCAGG - Intronic
1055549292 9:77415775-77415797 TCAATGGCCCAGATGGCTCAGGG - Intronic
1058152284 9:101476303-101476325 TCCAGAGCCCATGCGGATCCTGG - Exonic
1058742842 9:107960912-107960934 TCCAAGTCCCATGTTACTCATGG - Intergenic
1059420427 9:114187108-114187130 TCCATGGCCCAGGTGGCTGCTGG + Intronic
1061245579 9:129399847-129399869 TCCTGGGCCCCTGTGGGACAAGG - Intergenic
1062138386 9:134941971-134941993 TCCCAGGTCCATGTGGGTCACGG - Intergenic
1062282291 9:135757424-135757446 TCCAGGGCCGGTGAGGCTGAGGG - Intronic
1185464480 X:346463-346485 TCCTGGGCCCGTGTAGCTCCGGG - Intronic
1185617463 X:1432142-1432164 TCCGGGGGCCGTGTGGCACAGGG - Intronic
1187050980 X:15695384-15695406 TCCAGGGTCCCTGTGGGCCAAGG + Intronic
1188471992 X:30551467-30551489 TCCAGGCCACATGTGGCCCACGG - Intergenic
1188722692 X:33543166-33543188 TTCAGGGCCCATGAGGATCAAGG - Intergenic
1194310633 X:92301522-92301544 TCAAGTGCCCATGGGGATCATGG + Intronic
1195125287 X:101802930-101802952 TCCAGGCTCCCTGAGGCTCAGGG - Intergenic
1195179451 X:102342700-102342722 TCCAGGCTCCCTGAGGCTCAGGG + Intergenic
1195831238 X:109061134-109061156 ACCAGGGCCCATGTGGGTTAAGG + Intergenic
1196005551 X:110833448-110833470 TCCAGGGCACTTGGGTCTCAGGG - Intergenic
1196998971 X:121416740-121416762 TTCATGGCCCATGAGGGTCAAGG + Intergenic
1200000794 X:153058855-153058877 TCCAGGTCCCATGTGGCCTGGGG - Intronic
1200618914 Y:5415808-5415830 TCAAGTGCCCATGGGGATCATGG + Intronic
1200921748 Y:8619376-8619398 TCCAGCTCCCATTTGGCTCCAGG - Intergenic