ID: 1029713782

View in Genome Browser
Species Human (GRCh38)
Location 7:102314639-102314661
Sequence CGCTGCCGCCCGGGGATTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029713782_1029713788 8 Left 1029713782 7:102314639-102314661 CCTGGAATCCCCGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1029713788 7:102314670-102314692 AGCAATAACACAGGTGCCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 167
1029713782_1029713790 10 Left 1029713782 7:102314639-102314661 CCTGGAATCCCCGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1029713790 7:102314672-102314694 CAATAACACAGGTGCCAGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 157
1029713782_1029713789 9 Left 1029713782 7:102314639-102314661 CCTGGAATCCCCGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1029713789 7:102314671-102314693 GCAATAACACAGGTGCCAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1029713782_1029713787 -1 Left 1029713782 7:102314639-102314661 CCTGGAATCCCCGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1029713787 7:102314661-102314683 GGCAGTGACAGCAATAACACAGG 0: 1
1: 0
2: 0
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029713782 Original CRISPR CGCTGCCGCCCGGGGATTCC AGG (reversed) Exonic
900543998 1:3218397-3218419 GGCTGCCCCCTGGGGATACCTGG - Intronic
901059827 1:6466889-6466911 AGGTGCCCCCCGGGGATTCAGGG - Exonic
901459475 1:9383147-9383169 CCCCGCCTCCCGGGAATTCCAGG + Intergenic
903349820 1:22710920-22710942 CGCTCCCGCCCGGGCCGTCCGGG + Intronic
905252028 1:36655682-36655704 CGCTGCCTCCCTTTGATTCCTGG + Intergenic
907767315 1:57424018-57424040 CTCTGCAGCCCGGGGAAGCCCGG + Exonic
913651074 1:120913894-120913916 CGCTGCCCCCCGGGGGTCCTCGG - Intergenic
914170038 1:145215173-145215195 CGCTGCCCCCCGGGGGTCCTCGG + Intergenic
914437178 1:147670414-147670436 CGCTGCCGCCAGGGAACTCAGGG - Exonic
914525155 1:148459136-148459158 CGCTGCCCCCCGGGGGTCCTCGG + Intergenic
914598521 1:149176694-149176716 CGCTGCCCCCCGGGGGTCCTCGG - Intergenic
914641248 1:149607998-149608020 CGCTGCCCCCCGGGGGTCCTCGG - Intergenic
914803113 1:150974608-150974630 CGCTGCCGCCGGGTGAGTCGGGG - Exonic
917837585 1:178953431-178953453 CTCTGCCTCCCAGGGTTTCCTGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1062822716 10:547152-547174 CGCTGCAGCACCGGGATTCCGGG - Intronic
1064982014 10:21174352-21174374 CGCTGCAGGCCGGGGAGCCCAGG + Intergenic
1067066406 10:43106458-43106480 CGCTGCTCCCCGGGGACACCTGG + Exonic
1071055707 10:81505997-81506019 CGCTGCCCCGCGGGGAGGCCTGG - Intergenic
1071966564 10:90857999-90858021 CGCTGCCGCCCGGGCGCTCTCGG - Intergenic
1074591870 10:114821712-114821734 CGCCGCAGCCCGGGGAGGCCCGG - Intergenic
1075430428 10:122375224-122375246 CGCAGCTGCCCGGGGATTCCCGG + Intronic
1076351219 10:129816278-129816300 CGCCACCACCCGGGGATGCCTGG - Intergenic
1078660052 11:13278582-13278604 CCGTGCCGGCCGGGGATTCCCGG - Intronic
1081779943 11:45703245-45703267 CGCTGCCGCCCCTGCTTTCCTGG - Intergenic
1084013383 11:66365029-66365051 CTCTGCCTCCCTGGGATTACAGG + Intronic
1095981497 12:47977101-47977123 AGCTGGAGCCCGGGGAATCCAGG - Exonic
1103363744 12:120368574-120368596 CGCTGCCGCCGGCGGGTCCCGGG + Intronic
1103918824 12:124389116-124389138 CGCTGCGCCCCGGTGATACCTGG - Intronic
1105518270 13:21109824-21109846 CGCTTCAGCCCAGGAATTCCAGG - Intergenic
1107946010 13:45418289-45418311 CGCTGCCGCCAGGTAAGTCCTGG - Exonic
1114069857 14:19097999-19098021 CGCTGCAGCCAGGAGACTCCCGG + Intergenic
1114092405 14:19302003-19302025 CGCTGCAGCCAGGAGACTCCCGG - Intergenic
1118388816 14:65279752-65279774 GGCTGCCGCCGGGGCAGTCCAGG - Intergenic
1120346856 14:83301572-83301594 CGCTGCTGCCCCTGGCTTCCGGG + Intergenic
1121342699 14:93115030-93115052 CGCCGGCGCCCGGGGACCCCCGG - Intronic
1121825631 14:97007735-97007757 CGCTGTGGCCCGGGGTCTCCTGG + Intergenic
1127752505 15:62060110-62060132 CTCTGCCGCCCGCGGATTCTCGG - Intronic
1131250483 15:90827097-90827119 CGCTTCCTCCTGGGGGTTCCTGG + Intergenic
1132590769 16:725470-725492 GGCTGCTGCCCGGGGATGCCTGG + Exonic
1133054421 16:3138447-3138469 GGCTGCAGGCCGGGGATCCCAGG + Exonic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136496948 16:30650784-30650806 CGCCGCCTCCCGTGGATCCCGGG - Intronic
1138647191 16:58434174-58434196 CCTTGCAGCCCGGGGAGTCCTGG - Intergenic
1141770962 16:86089434-86089456 CGCTGCAGCCGAGGGATCCCAGG + Intergenic
1143499451 17:7330349-7330371 CGCTGCCGGCCGGGGATGCTCGG - Intergenic
1145255848 17:21321960-21321982 CTCTGCCTCCCGGAGATTTCTGG - Intergenic
1147659868 17:42111788-42111810 AGCAGCCGCCCGGGTCTTCCCGG + Exonic
1148471447 17:47896306-47896328 CGCTGCCGGCGGGGTCTTCCCGG + Intronic
1152107903 17:78341741-78341763 AGCTGCGGCCCCGGGCTTCCCGG - Intergenic
1153900616 18:9614505-9614527 CGCGGCCGCCCGGGGAGCCGGGG + Exonic
1155240272 18:23857851-23857873 CACTGCCGCCCTGTGATTCTGGG - Exonic
1160680408 19:409381-409403 CGCTCACGCCCGCAGATTCCGGG + Intergenic
1160896925 19:1407520-1407542 CGCTCCCGCACGGGGTCTCCGGG - Intergenic
1161317380 19:3623937-3623959 CGCGGCCGCCCGGGGGCTCTGGG + Exonic
1161991003 19:7684192-7684214 CGAGGCCCCCAGGGGATTCCTGG + Exonic
1163478149 19:17539169-17539191 CCCTGCTGCCCGGGCCTTCCTGG + Exonic
1165955485 19:39499479-39499501 TGCTGCCCCCGGGGGACTCCCGG + Intronic
1166092583 19:40519818-40519840 CGCTGCCGCCCGCCGCCTCCTGG - Exonic
1166660495 19:44643970-44643992 AGCGGCCCCCCGGGGATTCCAGG + Exonic
1166852831 19:45768634-45768656 CGGGGACGCCCGGGGATCCCGGG + Exonic
1167566735 19:50261606-50261628 GGCAGCTGCCCGGGGATACCTGG + Exonic
1168406068 19:56111336-56111358 AGCTGCTGCCCTGGAATTCCTGG + Intronic
931348999 2:61471358-61471380 CGCGGCCGCGGGGGGAGTCCGGG + Intergenic
933810504 2:86030010-86030032 GTCTGCCTCCCGGGGATTCTGGG - Intronic
935653119 2:105398975-105398997 CGCAGCGGGCCGGGGACTCCCGG + Intronic
939900542 2:147844736-147844758 CGCTGCCGCCCGGACAGTCTGGG - Exonic
940969105 2:159875626-159875648 CGCAGCCGCCCGGGGAAGCTGGG + Exonic
942453654 2:176123356-176123378 CGCTGCTCCCCTGGGACTCCCGG - Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946474527 2:219994748-219994770 CTCTTCCTCCCAGGGATTCCTGG + Intergenic
947885541 2:233566653-233566675 GGCTGGCGCCCGGGGATCCTGGG - Intronic
1171390308 20:24797482-24797504 ATCTGCCCCCCGGGGACTCCAGG + Intergenic
1172645774 20:36468396-36468418 CTCTGCCCACTGGGGATTCCTGG - Intronic
1175860808 20:62149119-62149141 ACCTGCAGCCCGGGGATTCCAGG - Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1180488323 22:15820563-15820585 CGCTGCAGCCAGGAGACTCCCGG + Intergenic
1181964187 22:26645237-26645259 CGCGGCCTCCCTGGGACTCCGGG - Intergenic
1184004305 22:41697341-41697363 CGCTGCCGGCCTGGGGGTCCTGG - Exonic
1185021596 22:48379843-48379865 CTCTGCCCCCAGGGGATGCCTGG - Intergenic
1185216343 22:49601955-49601977 CCCTGCCCTCCGGGAATTCCAGG - Intronic
954378852 3:50209039-50209061 GGCCGCCTCCAGGGGATTCCGGG + Intronic
954904825 3:54051758-54051780 CACTGCAGCCCTGGGATTACAGG - Intergenic
962222250 3:133573808-133573830 CGCTGTCGCCCGAGGCTGCCGGG - Exonic
962250555 3:133833527-133833549 TGCTGCAGCCCTGGGACTCCTGG + Intronic
963582802 3:147147671-147147693 GGCTGCAGCCCTGGGATACCAGG - Intergenic
966860941 3:184230563-184230585 CGCTGCCGCTCACGGACTCCTGG + Exonic
967859604 3:194141297-194141319 CGGGGCGGCCCGGGGGTTCCAGG + Intergenic
968659635 4:1793702-1793724 CGCCGCCGCCCAGGGCTCCCGGG - Intronic
971351789 4:25862528-25862550 CGCTGCGCCCCGGGCGTTCCCGG - Intronic
972690270 4:41390303-41390325 CTCTGCCTCCCTGGAATTCCGGG + Intronic
978777176 4:112515895-112515917 CGCAGCTGCGCGGAGATTCCCGG - Exonic
982198543 4:152937829-152937851 CGCGGCTCCCCGGGGATTCGCGG + Intronic
989571619 5:42951188-42951210 CGCCGCCGCCCGGTAACTCCAGG + Intergenic
989576454 5:42992654-42992676 CGCCGCCGCCCGGGAACGCCAGG - Intergenic
989983329 5:50667619-50667641 CGCTGCCCCCCGGGGGTCCTCGG - Intronic
1001507977 5:172295479-172295501 CTCAGCCTCCCGGGGATTACAGG - Intergenic
1002888012 6:1312761-1312783 CGCTGCCGCCCGCGCCCTCCAGG - Exonic
1008276679 6:49550929-49550951 CCCTGCCGTCGCGGGATTCCGGG - Exonic
1012550172 6:100458273-100458295 CGATGTCGCCCTGGGACTCCGGG + Intronic
1013349200 6:109290575-109290597 CGCTGCCGGGCGGGGCTTCAGGG - Intergenic
1017446132 6:154509464-154509486 CACTGCCTCCCGGGGAGTCCTGG + Intronic
1018758249 6:166867978-166868000 CTCTGCCTCCCTGGGATTACAGG - Intronic
1018941046 6:168308946-168308968 CCCTGCCGCCCTGGGACACCAGG + Exonic
1019280318 7:196499-196521 AGCTGCTCCCCGGGGATTGCAGG + Intronic
1019483197 7:1275547-1275569 CGCTCCTGCCCGGGGACTCGCGG - Intergenic
1019726474 7:2605729-2605751 CCCTGCCTCCCGGGAATTGCTGG - Intronic
1023435127 7:40134465-40134487 CGCCCCCGCCCGGGGTTCCCCGG + Exonic
1029713782 7:102314639-102314661 CGCTGCCGCCCGGGGATTCCAGG - Exonic
1030303895 7:108001428-108001450 CGCAGCCAGCCGGGGAGTCCCGG - Intronic
1034986850 7:155521544-155521566 GGCTGCCGCCTGGCGATTTCAGG - Intronic
1035316849 7:158001904-158001926 CGCTGCTGCACTGGGACTCCTGG + Intronic
1038721314 8:30038485-30038507 CGCTTCAGCCCAGGAATTCCGGG + Intergenic
1039875124 8:41578427-41578449 CGCCGCGCCCCGGGGATCCCCGG + Intronic
1039875184 8:41578591-41578613 CCCTCCCGCCCCGGGAGTCCGGG + Intronic
1048443877 8:134478999-134479021 AGCTGCTTCCCGGGGCTTCCAGG + Intronic
1049658414 8:143808978-143809000 CACTGCTGCCCGGGGATGACAGG - Exonic
1049850870 8:144829432-144829454 GGCTGGCACCCAGGGATTCCTGG + Exonic
1057177012 9:93007790-93007812 CTTTGCCCCCCGGGGATCCCAGG + Intronic
1058686969 9:107488393-107488415 CGCTGGCGCCCTGGGTTCCCGGG - Intronic
1061134259 9:128724159-128724181 CGCCGCCGCCCGGGGACTGGTGG + Intergenic
1061728465 9:132594818-132594840 CACTGCCACCCGGGGCTTCCAGG + Exonic
1061883665 9:133580112-133580134 CCCCGCCGCCCGGGAATACCTGG + Exonic
1062041719 9:134407502-134407524 CGCTGCCGCCCGGGCAAGCGTGG - Intronic
1062218387 9:135401422-135401444 TGCTGCCGCCCTGGGCTGCCGGG - Intergenic
1062402960 9:136380465-136380487 CGCTGTCTGCCGGGGATGCCTGG - Intronic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic
1189333889 X:40158401-40158423 GGCTGCCGCGCGGGCGTTCCCGG + Intronic
1192630804 X:72776902-72776924 CTCCGCCGCCCGGGTCTTCCCGG - Intergenic
1192650906 X:72943902-72943924 CTCCGCCGCCCGGGTCTTCCCGG + Intergenic
1194600350 X:95913197-95913219 AGCTGCCGCCTGGGGGTTCCTGG + Intergenic
1198207816 X:134484923-134484945 CTCTGCCTCCCTGGGATTACAGG + Intronic