ID: 1029714173

View in Genome Browser
Species Human (GRCh38)
Location 7:102317173-102317195
Sequence CATCCCCACCTCAGGGGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 215}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029714166_1029714173 -3 Left 1029714166 7:102317153-102317175 CCCCATGTTCCTCACACTGTCAT 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714159_1029714173 13 Left 1029714159 7:102317137-102317159 CCCCCTTTCTCCTTCCCCCCATG 0: 1
1: 0
2: 8
3: 95
4: 992
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714168_1029714173 -5 Left 1029714168 7:102317155-102317177 CCATGTTCCTCACACTGTCATCC 0: 1
1: 0
2: 0
3: 39
4: 310
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714162_1029714173 10 Left 1029714162 7:102317140-102317162 CCTTTCTCCTTCCCCCCATGTTC 0: 1
1: 1
2: 4
3: 65
4: 810
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714165_1029714173 -2 Left 1029714165 7:102317152-102317174 CCCCCATGTTCCTCACACTGTCA 0: 1
1: 0
2: 2
3: 23
4: 252
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714160_1029714173 12 Left 1029714160 7:102317138-102317160 CCCCTTTCTCCTTCCCCCCATGT 0: 1
1: 0
2: 5
3: 77
4: 861
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714164_1029714173 -1 Left 1029714164 7:102317151-102317173 CCCCCCATGTTCCTCACACTGTC 0: 1
1: 0
2: 0
3: 22
4: 271
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714167_1029714173 -4 Left 1029714167 7:102317154-102317176 CCCATGTTCCTCACACTGTCATC 0: 1
1: 0
2: 2
3: 20
4: 208
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714163_1029714173 3 Left 1029714163 7:102317147-102317169 CCTTCCCCCCATGTTCCTCACAC 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215
1029714161_1029714173 11 Left 1029714161 7:102317139-102317161 CCCTTTCTCCTTCCCCCCATGTT 0: 1
1: 0
2: 4
3: 72
4: 791
Right 1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG 0: 1
1: 0
2: 2
3: 23
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029714173 Original CRISPR CATCCCCACCTCAGGGGAAC AGG Exonic
900098386 1:949811-949833 CATCCCTGCCTCAGTGGAAGGGG + Intronic
900114820 1:1023986-1024008 CAGCCCCACCCCAGGGGGTCCGG - Intronic
900436066 1:2631906-2631928 GATCCCCACCACAGGGGCCCAGG + Intronic
901688750 1:10959245-10959267 CCTCCCCACTGCTGGGGAACCGG - Intronic
901765222 1:11495712-11495734 TCTCCCCATCTCAGGGGAATAGG + Intronic
902404562 1:16175645-16175667 AGTCCCCACCTCAGGGGCCCTGG + Intergenic
902794697 1:18793515-18793537 CCTCCCCAGCTTAGGGGTACAGG + Intergenic
902978864 1:20109143-20109165 CATCCTGACCTCAGGGCACCAGG - Intergenic
903008775 1:20315937-20315959 CATCCGGACCTCAGTGGATCAGG + Intronic
903443743 1:23407513-23407535 CACCCCCACCTCAGGGCACTTGG + Intronic
904255277 1:29250790-29250812 CATTCCCATCTCAAGGGACCAGG + Intronic
904521764 1:31101307-31101329 CCTCCCCAGGTCAGGGGAAAAGG - Intergenic
905046217 1:35004683-35004705 CACCCCCGCCTCAGGGGAGTGGG - Intronic
907372752 1:54013853-54013875 CATCTCCACCACAGGGGACCGGG - Intronic
910679907 1:89852476-89852498 CATCCCCACCTCCTGTGTACTGG + Intronic
912392146 1:109310777-109310799 CATACCCACCCCAGGGTAACGGG - Exonic
912982391 1:114387376-114387398 TACCCCCTCCTCAGGGAAACTGG - Intergenic
914241736 1:145857405-145857427 CATCCCAGCCTCCTGGGAACAGG + Intronic
915242974 1:154537050-154537072 CATCCCCACCTTAGGGCCTCTGG + Intronic
916214326 1:162382834-162382856 CATTCCCACCTCAGATGCACAGG - Intronic
917170198 1:172164528-172164550 CCTCACCACCTCAGGAGAAGTGG - Intronic
918054175 1:181004420-181004442 TAACCCCACCCCAGGGGAAAGGG + Intronic
918740766 1:188128129-188128151 CATCATCATCTCAGGGGAGCAGG - Intergenic
919539934 1:198833760-198833782 CTTTCTCACCTCAGGGGATCTGG - Intergenic
919747433 1:201017459-201017481 CACCCCCATCTCAGGGCATCTGG + Intronic
922452277 1:225746832-225746854 CAGCCCCACCTGACGGGATCAGG + Intergenic
922987113 1:229874466-229874488 CATCGCCATCCAAGGGGAACGGG + Intergenic
923972323 1:239218401-239218423 ATTCATCACCTCAGGGGAACTGG - Intergenic
1064406536 10:15069306-15069328 CATCCCTTCCTCAGGGGTAGAGG + Intronic
1066514706 10:36144940-36144962 CACTCCCACATCAGGGGTACTGG + Intergenic
1070327631 10:75398946-75398968 CATCCCCACCTCGGGCGCACCGG - Exonic
1070645599 10:78200034-78200056 CATCACCACCCCAGGAGACCTGG - Intergenic
1073096900 10:100985363-100985385 CATCCTCACCCGAGGGGAATGGG - Exonic
1073486145 10:103820341-103820363 CTTCCCCTCCTGAGGGGACCTGG - Intronic
1074773216 10:116746532-116746554 CCTGCCCACCTCAGGGGACCTGG + Intergenic
1076151384 10:128164313-128164335 CATCCACAGCTCAGGGGGCCAGG + Intergenic
1076702759 10:132282771-132282793 CAGCCACTCCTCTGGGGAACCGG + Intronic
1076856229 10:133116673-133116695 CATCCCCACCACTGAGGAAGGGG - Intronic
1077594662 11:3521561-3521583 GATCACCACTTCAGGGGAAAGGG + Intergenic
1083257789 11:61507390-61507412 CATCCCCACTGCAGGGGAAGGGG - Intergenic
1083656417 11:64231968-64231990 CCTCCCCACCTCAGGGGTACGGG - Intronic
1084250505 11:67894825-67894847 GATCACCACTTCAGGGGAAAGGG + Intergenic
1084490939 11:69477945-69477967 CATCCCCACCACAGGGGCCACGG - Intergenic
1084548183 11:69824970-69824992 CTTCCTCAGCTCAGGGAAACAGG - Intergenic
1084822273 11:71700513-71700535 GATCACCACTTCAGGGGAAAGGG - Intergenic
1085048676 11:73368221-73368243 CACCCCCACCCCAGGTGACCAGG - Exonic
1085335234 11:75688260-75688282 CATACCCACGACAGGGGCACCGG - Intergenic
1088333444 11:108676892-108676914 CACCCCCAACTCAGAGGAAAGGG - Intronic
1088598708 11:111457597-111457619 CTTCCCCTCCCCAGGGGCACTGG - Intronic
1088810290 11:113387573-113387595 CATCCCTCCCTAGGGGGAACTGG + Intergenic
1089012650 11:115143407-115143429 CATTCCCACCTTTGGGGATCAGG + Intergenic
1089116392 11:116098541-116098563 CATCCCATTCTCAGGGGGACTGG - Intergenic
1089466816 11:118690895-118690917 CATCCCCTCATCTGGGGAAAGGG + Intergenic
1091042220 11:132292411-132292433 CTCCCCCACCTCAGTGGAGCAGG + Intronic
1095915599 12:47475010-47475032 CATCACAATCTCAGGGGAGCAGG - Intergenic
1095982441 12:47981061-47981083 GATCCCCGTCTCTGGGGAACAGG - Intronic
1096522050 12:52189882-52189904 CATCCCCATGGCAGGGGCACAGG + Intronic
1096622799 12:52874807-52874829 CTTCCCCACTTCTGGGGAAGTGG - Intergenic
1097226177 12:57477924-57477946 CACCCCCACCTCAGGGCCACAGG + Intronic
1101196996 12:102393854-102393876 CATTCCCACCTAAGTGAAACTGG - Intergenic
1103328517 12:120137707-120137729 CATGCCCACCTCAGGGCTGCGGG + Exonic
1103961628 12:124612517-124612539 CAAGCCCAGCTCAGGGGCACTGG + Intergenic
1104944705 12:132410406-132410428 CCTCCCCAGCTCAGGGCGACAGG + Intergenic
1108282591 13:48874661-48874683 CATCCCCTCCCCAAGGGAAATGG + Intergenic
1108589120 13:51896576-51896598 CATCCCCCTCTCAGGGCATCCGG - Intergenic
1114617106 14:24074210-24074232 CACCCCCACCTAAGGGAAAGGGG + Intronic
1114756744 14:25268700-25268722 AAGCCCCACCCCAGGGGAATGGG - Intergenic
1120664018 14:87284309-87284331 CATCCCCATCACAGGGAATCAGG - Intergenic
1121343807 14:93120561-93120583 CAGCCCCACCCCAGGGCTACAGG + Intergenic
1122941066 14:104981635-104981657 CTTCCCCACCTCAAGGAACCTGG + Intergenic
1123137048 14:106037817-106037839 CCTCCCCACCTCTGCAGAACAGG - Intergenic
1123206990 14:106723489-106723511 CCTCCCCACCTCTGCAGAACAGG - Intergenic
1123212009 14:106770492-106770514 CCTCCCCACCTCTGCAGAACAGG - Intergenic
1123449018 15:20348996-20349018 CATCCCCAGCTCACAGGCACAGG - Intergenic
1126953928 15:53912324-53912346 GTTGCCCAACTCAGGGGAACTGG + Intergenic
1128656827 15:69468869-69468891 CATTCCCAGCCAAGGGGAACGGG - Intergenic
1129104432 15:73296351-73296373 CATCCCCACGGCGGGGGAGCTGG - Intronic
1129953860 15:79615405-79615427 CATCCCCATCTCAGGGGAAGAGG + Intergenic
1131403327 15:92143960-92143982 CATGCCCACCTCTGGTGACCTGG - Intronic
1131619493 15:94052676-94052698 CAGCCTCACCTCAGGGGACAGGG - Intergenic
1132145350 15:99426040-99426062 CATCCCCGCCTCAGGCTAGCTGG + Intergenic
1132329865 15:101004762-101004784 CAGCCCCAGCTCAGGGGATGTGG + Intronic
1132764008 16:1525363-1525385 CATCCCAGCCCCACGGGAACCGG + Intronic
1133359553 16:5163397-5163419 GATCACCACTTCAGGGGAAAGGG + Intergenic
1134868139 16:17627392-17627414 CATTCCCATTTCAGGGGAAGGGG - Intergenic
1137538329 16:49344336-49344358 CATCCCCACCTGAGGAGACGGGG - Intergenic
1138202516 16:55100767-55100789 CAACCCCACCTCAGTGGCAGGGG + Intergenic
1138556476 16:57773926-57773948 CACCCCCACCTCTGAGGAAAAGG + Intronic
1141715695 16:85725474-85725496 CATCCCAACCTCTGGGGAATGGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147386241 17:40084011-40084033 CATCCCCACCCCAGGCCACCTGG - Intronic
1148217272 17:45840041-45840063 CATCCTCATCACAGGGGAAGGGG + Intergenic
1150003961 17:61458119-61458141 CATCCCCATCTCTGGCCAACGGG + Intronic
1151189301 17:72386589-72386611 CAGCCCCACCTCAGGGATTCTGG - Intergenic
1153836139 18:8965704-8965726 GCACCCCACCTCAGGGGAAGAGG + Intergenic
1158560230 18:58507297-58507319 CATCCCTACCCCAGGGCAGCTGG - Intronic
1160501437 18:79403050-79403072 CAGCCCCTTCTCAGGGGATCCGG - Intronic
1161714541 19:5867850-5867872 AATCCTCAACTCAGGGGTACTGG - Intronic
1161800816 19:6415949-6415971 CATCCCCACCCCAGGTGGTCCGG - Intronic
1162445470 19:10719805-10719827 CATCCCCACCTTAGCTGAGCTGG + Intronic
1163020792 19:14479925-14479947 CACCCCCACCTCAGGGGCCTGGG + Intronic
1165423195 19:35732402-35732424 CACACCTACCTCAGGGGAGCTGG + Exonic
1166702236 19:44888846-44888868 CTTTCCCACCTTTGGGGAACAGG - Exonic
1167392021 19:49201822-49201844 ACTCCCCACCTCAGGTGATCCGG + Intronic
1168153354 19:54460602-54460624 CCTCCCCACCTCAGGGGCTCGGG - Intronic
925708616 2:6715551-6715573 CATCCCCACATCAGGACCACTGG - Intergenic
931233641 2:60395227-60395249 CATCCCCAAATCAGGAGCACTGG - Intergenic
931910834 2:66898088-66898110 CATCCCCATGTCTGGGGAGCCGG - Intergenic
932699163 2:73981712-73981734 CATCACCATCTCCTGGGAACTGG - Intergenic
933281922 2:80341232-80341254 CATCCCCACCTCTGGGGAGGAGG - Intronic
934791919 2:97068981-97069003 CATCCTACCCTCAGGGGACCTGG + Intergenic
934814700 2:97314729-97314751 CATCCTACCCTCAGGGGACCTGG - Intergenic
934822994 2:97393754-97393776 CATCCTACCCTCAGGGGACCTGG + Intergenic
935341867 2:102065805-102065827 CATCCCCACTTAAGGGGACTAGG + Intronic
936374180 2:111926833-111926855 CATCCACACATCAGAGGAAGGGG + Intronic
937062897 2:118993324-118993346 CATCCACACCTCTGGGGAAGAGG - Intronic
937086340 2:119174400-119174422 CAGCCCCTCCTCAGGGAAGCGGG + Intergenic
937095562 2:119233123-119233145 CACCCCCACCTAATGGGGACTGG + Intronic
937432020 2:121846704-121846726 CATCCTCACCCCTGGGAAACGGG - Intergenic
937445207 2:121951600-121951622 CATCCACATCTCAGGGGCTCAGG - Intergenic
939657056 2:144839005-144839027 TATGCCCAGCTCAAGGGAACAGG + Intergenic
940404408 2:153284165-153284187 CACCACAATCTCAGGGGAACTGG + Intergenic
941040102 2:160611838-160611860 AATCCCCACTTCCTGGGAACAGG + Intergenic
942139576 2:172964593-172964615 CAGCACCACCTCTGGGGCACGGG - Intronic
944314581 2:198270918-198270940 CATACCCACCTCAACTGAACAGG - Intronic
946392643 2:219425861-219425883 CATCCCCACCCCAGGGCCGCAGG - Intronic
948575569 2:238947348-238947370 CAGCCCCCCCTCAGGAGCACAGG + Intergenic
948999857 2:241607069-241607091 CAGCCCCTCCTCAGGGAAGCGGG - Intronic
1169248745 20:4044576-4044598 CAGGGCCATCTCAGGGGAACAGG - Intergenic
1170807250 20:19643156-19643178 CATCTGCACCTGAGGGGGACAGG + Intronic
1171135429 20:22690827-22690849 CTTCTCCACCTGAGGGGAACGGG + Intergenic
1172014050 20:31862562-31862584 CATCCCTACCTTCTGGGAACTGG + Exonic
1172934108 20:38607375-38607397 GATCCGCAGCTCAGGGGACCAGG + Intronic
1173931913 20:46827827-46827849 AATCCCCACCTCAGGGTACATGG + Intergenic
1175130155 20:56782634-56782656 CATCCCCAGCCAAGGGGACCTGG - Intergenic
1175509693 20:59515479-59515501 CTCACCCACCTCAGGGGAACTGG + Intergenic
1179711177 21:43264073-43264095 CTTCCCCTCCCCAGGGGAAGGGG - Intergenic
1179842662 21:44087369-44087391 CACCCCCACCCCAGGGGAGCAGG - Intronic
1181695407 22:24590495-24590517 CAACACTACCTCAAGGGAACTGG - Intronic
1182972200 22:34589358-34589380 CCTCGCCACCTCAGGGGGCCGGG - Intergenic
1183485846 22:38087332-38087354 CATCCTCCCCTCAGGGTCACTGG + Intronic
1184403006 22:44284773-44284795 CATCCCCACCATACTGGAACTGG + Intronic
1184798863 22:46748158-46748180 CACACCCTCCTCAGGGGATCTGG + Intergenic
1184945010 22:47796556-47796578 CACCCCCACCTCAGCCAAACTGG - Intergenic
949970299 3:9397838-9397860 CACCCCCACCTCACGGGTACGGG + Exonic
950867000 3:16197253-16197275 CAGCCCCACCAGAGGGGATCTGG + Intronic
952880692 3:37984568-37984590 TATCCCCACTTCCGGGGAACAGG + Intergenic
954148423 3:48645733-48645755 CAGCCCCACCTCACGGGGAGAGG + Exonic
954330068 3:49885078-49885100 CATCCCCACCTCAGTTGGAAAGG - Intergenic
954423449 3:50430881-50430903 CATCCCCAAGTCTGGGAAACAGG - Intronic
954709951 3:52500621-52500643 CATCCTCAACTCATGGGCACAGG - Intronic
954895184 3:53969195-53969217 CAACCCCACTGCAGGGGACCAGG + Intergenic
955773648 3:62411281-62411303 CAGCCACACCTCAGAGAAACTGG + Intronic
956134049 3:66081657-66081679 CATCACCACTTCAGAGGAGCAGG - Intergenic
961288547 3:125826498-125826520 GATCACCACTTCAGGGGAAAGGG - Intergenic
961306454 3:125961207-125961229 TCTCCAGACCTCAGGGGAACTGG + Intergenic
961695559 3:128701712-128701734 CAGGCCCACCAGAGGGGAACTGG + Intergenic
961898511 3:130189547-130189569 GATCTCCACTTCAGGGGAAAGGG + Intergenic
962388416 3:134951922-134951944 CATCCCCAACGCAGAGGAAGTGG + Exonic
964652447 3:159026778-159026800 CACCGCAACCTCAGGGTAACAGG + Intronic
964652586 3:159028130-159028152 CACCGCAACCTCAGGGAAACAGG - Intronic
964849746 3:161082250-161082272 CTTCCCCACCTCAGTGACACTGG + Intergenic
964960512 3:162417885-162417907 CATCCTTTCCTCAGGGGAAAGGG + Intergenic
965438100 3:168677525-168677547 CCTCCTCACCTCAGGAGATCCGG - Intergenic
968866482 4:3215954-3215976 CACCCCCACCTCTGTGGGACAGG - Intronic
968922184 4:3528002-3528024 CAGCCACACATCAGGGGAAAGGG - Intronic
969009494 4:4050045-4050067 GATCACCACTTCAGGGGAAAGGG + Intergenic
969301854 4:6301642-6301664 CATCCCCACCACAGAGAAGCTGG - Exonic
969433951 4:7173307-7173329 CATCCCCACCTCACAGGGAGAGG + Intergenic
969744856 4:9062269-9062291 GATCACCACTTCAGGGGAAAGGG - Intergenic
969804273 4:9594375-9594397 GATCACCACTTCAGGGGAAAGGG - Intergenic
969825924 4:9758543-9758565 CATCCACATCTCAGGGGTGCAGG + Intergenic
974034842 4:56808929-56808951 CATCCACGCCTGAGAGGAACAGG + Intergenic
974560824 4:63514844-63514866 AATCCCCACCTCAGGATAAAAGG + Intergenic
976620408 4:87121186-87121208 CATCCCCACTTCAGGGAATCTGG - Intronic
985940781 5:3134020-3134042 CACCCCCACCCCAGGGGAAGGGG - Intergenic
986057661 5:4154499-4154521 CATCCCCACATCAAAGAAACTGG + Intergenic
986508535 5:8478374-8478396 CCTCCCCAGCCCTGGGGAACTGG - Intergenic
992056711 5:72997655-72997677 CAACCCCAACTCAGGTGAAGGGG - Intronic
994770270 5:103973169-103973191 CAGCCCCACCTCTCTGGAACAGG + Intergenic
995245709 5:109932906-109932928 CACCCGCACCTCAGGGGAAGAGG - Intergenic
997241718 5:132312599-132312621 CACCACCACCTCAGGGGTAGGGG + Intronic
999765949 5:154740976-154740998 CATCCTCTCCTCAGGGGCACTGG + Intronic
1000245859 5:159447852-159447874 CATCCCCACCTTATGAGAATGGG - Intergenic
1001667074 5:173442051-173442073 CACCACCACCACAGGGGAAATGG + Intergenic
1001952337 5:175824988-175825010 CATTCCCTCCTCTGAGGAACTGG + Intronic
1002361844 5:178678294-178678316 CATCCATACCACAGGGGAAGGGG + Intergenic
1004340488 6:14803810-14803832 CATCCCCACGCCTGGGGCACAGG + Intergenic
1004385631 6:15170398-15170420 CAGCCCCAGCTCAGAGGAGCTGG + Intergenic
1005867301 6:29945666-29945688 CAGCCCCACCTCTCTGGAACAGG - Exonic
1006042632 6:31268936-31268958 CAGCCCCACCTCTCTGGAACAGG + Exonic
1006804793 6:36781098-36781120 CTTCCCCATCCCAGGGTAACCGG - Intronic
1007697263 6:43741534-43741556 CATCCCCAACTCAGGAGGCCTGG - Intergenic
1007766364 6:44162608-44162630 CACCCCACCCTCAGGGGAATGGG + Intronic
1008636166 6:53412976-53412998 CAACCCCAACTCAGGGGATTGGG - Intergenic
1009787590 6:68358908-68358930 CACCACAATCTCAGGGGAACAGG + Intergenic
1010989021 6:82458603-82458625 CACCTCAATCTCAGGGGAACAGG + Intergenic
1014126628 6:117783537-117783559 CAGCCACTCCTCAGGGAAACTGG + Intergenic
1016220811 6:141668241-141668263 CATCACAAACTCAGGGGAGCAGG - Intergenic
1018612981 6:165661909-165661931 CCGCCCCACCTCCGGGGAACGGG + Intronic
1019170580 6:170131191-170131213 CAGCCAGACCTCAGGGGAAGGGG - Intergenic
1019810829 7:3164057-3164079 CAGCCCCAACTCAGGGTTACAGG - Intronic
1021151114 7:17151628-17151650 CACCCCCAGCTCAGGAGAAGTGG + Intergenic
1022103626 7:27183574-27183596 CCTCCCCACCTCGGCGGAGCCGG - Intronic
1022486888 7:30785979-30786001 CAGCCCCACCTGTGGGGAGCTGG - Exonic
1022533933 7:31084265-31084287 CCTCACCACCTCTGGGGAGCAGG - Intronic
1028325421 7:89518357-89518379 CACCCCCACAGCAAGGGAACTGG + Intergenic
1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG + Exonic
1031901359 7:127414995-127415017 CATCCCAACCCCGGGGCAACAGG + Intronic
1032535732 7:132662010-132662032 CATTCCCACCTTGTGGGAACTGG + Exonic
1034283786 7:149871280-149871302 CAGCTCCACCTCAGGGGACCGGG + Intergenic
1035115280 7:156518621-156518643 CATCCCCACCTCTGGAGTATGGG + Intergenic
1036757387 8:11480386-11480408 GATCTCAACCTCAGGAGAACTGG + Intergenic
1039190800 8:34971838-34971860 CATCCCCACCCCAGGAGCCCAGG - Intergenic
1039890578 8:41682938-41682960 CAGCCTCCCCTCAGGGGACCTGG - Intronic
1039912570 8:41836513-41836535 CACCACCACCTCAGGGGAGGGGG - Intronic
1041694547 8:60721669-60721691 CATCAGCACCGCTGGGGAACTGG - Intronic
1042406787 8:68415044-68415066 CTTCCACACCTCAGGTCAACAGG - Intronic
1045076219 8:98571438-98571460 TATCACCACCTGAGGGGAATGGG + Intronic
1045270143 8:100654608-100654630 GACCCCCACCCCAGGGGACCTGG + Intronic
1047017516 8:120739248-120739270 CAAACCTTCCTCAGGGGAACAGG + Intronic
1048674225 8:136759443-136759465 CATCCACACTTCTGGGGAGCTGG + Intergenic
1054332645 9:63775239-63775261 CATCCCCAACTCCTGGGCACTGG + Intergenic
1055411734 9:76037724-76037746 CATCCCCTCCTTAGGGTAAGAGG - Intronic
1060973910 9:127754098-127754120 CACCCCCAACTCTAGGGAACTGG - Intronic
1061078280 9:128355039-128355061 CTTCCCCACCCCAGGTGAGCCGG + Exonic
1061869376 9:133512812-133512834 CATCCACCCAGCAGGGGAACTGG - Intergenic
1062141242 9:134960273-134960295 CATTCCCACCCCAGGGCCACTGG + Intergenic
1202799648 9_KI270719v1_random:163550-163572 CATCCCCAACTCCTGGGCACTGG + Intergenic
1185883573 X:3761673-3761695 CATCTCCACCTCAGGGTGCCAGG - Intergenic
1189052532 X:37661535-37661557 TATCCCCACCTCAAGGGTATTGG + Intronic
1189364967 X:40381127-40381149 CCTCCCCACCTCAGGGAGTCAGG - Intergenic
1190073203 X:47295681-47295703 CATGCCCACCTCATGGAAACTGG - Intergenic
1190324831 X:49200019-49200041 CATCCCCAGCGCCGGGGACCGGG + Intronic
1191087948 X:56588744-56588766 CACCACGATCTCAGGGGAACAGG + Intergenic
1191774010 X:64792984-64793006 CACCACCATCTCAGGGAAACAGG - Intergenic
1191965966 X:66758519-66758541 CTTCCCCAGCTCAAGGGAACTGG + Intergenic
1192549889 X:72045391-72045413 CAACCCCACCACAAGGGACCTGG - Intergenic
1198017373 X:132624972-132624994 CCTACCCTCCTCAGGGGAAAAGG + Intergenic
1199051205 X:143239048-143239070 CATCCCCACCATCAGGGAACAGG + Intergenic
1200072611 X:153536578-153536600 CATCTCCCCCTCAAGGGAAATGG - Intronic