ID: 1029714737

View in Genome Browser
Species Human (GRCh38)
Location 7:102319806-102319828
Sequence CTGTGGGAACAGCTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029714737_1029714753 28 Left 1029714737 7:102319806-102319828 CCCTGTTCCAGCTGTTCCCACAG 0: 1
1: 1
2: 2
3: 39
4: 301
Right 1029714753 7:102319857-102319879 TGGGGAGCTTTCCATGCCTCCGG No data
1029714737_1029714745 10 Left 1029714737 7:102319806-102319828 CCCTGTTCCAGCTGTTCCCACAG 0: 1
1: 1
2: 2
3: 39
4: 301
Right 1029714745 7:102319839-102319861 CTCCTCCCCAGCCAGCCCTGGGG No data
1029714737_1029714744 9 Left 1029714737 7:102319806-102319828 CCCTGTTCCAGCTGTTCCCACAG 0: 1
1: 1
2: 2
3: 39
4: 301
Right 1029714744 7:102319838-102319860 ACTCCTCCCCAGCCAGCCCTGGG 0: 1
1: 1
2: 8
3: 56
4: 435
1029714737_1029714754 29 Left 1029714737 7:102319806-102319828 CCCTGTTCCAGCTGTTCCCACAG 0: 1
1: 1
2: 2
3: 39
4: 301
Right 1029714754 7:102319858-102319880 GGGGAGCTTTCCATGCCTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 176
1029714737_1029714743 8 Left 1029714737 7:102319806-102319828 CCCTGTTCCAGCTGTTCCCACAG 0: 1
1: 1
2: 2
3: 39
4: 301
Right 1029714743 7:102319837-102319859 CACTCCTCCCCAGCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029714737 Original CRISPR CTGTGGGAACAGCTGGAACA GGG (reversed) Intronic
900162377 1:1230171-1230193 TTGAGGGAACAGCTGTGACATGG - Intronic
900762611 1:4483062-4483084 CTGTGGGAAAATATGGCACAGGG - Intergenic
901148631 1:7085645-7085667 ATGTGGGCAGAGCTGGCACATGG + Intronic
901456537 1:9366257-9366279 CTGGGGGATCAGCTGAAACTGGG + Intronic
902256946 1:15195710-15195732 CTGAGGGAAGAGCTGGCCCAGGG + Intronic
902546924 1:17195927-17195949 GTGTGGGGACAGCTGGAAACTGG + Intergenic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
902638753 1:17752513-17752535 CAATGGGAACAGTTGGAACCAGG + Intergenic
903016183 1:20363622-20363644 CAGTAGGAGCAGCTGGAACCTGG - Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
905052156 1:35060947-35060969 CTCTGGGCCCACCTGGAACAGGG + Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908934377 1:69357149-69357171 CACTGGCAACAGTTGGAACAAGG - Intergenic
909781103 1:79548811-79548833 CTTTGGGAAAGGCTGGAAAAAGG - Intergenic
911663485 1:100529392-100529414 TTGTGGGACCATCTGGTACAAGG + Intergenic
911903162 1:103530426-103530448 TTAGAGGAACAGCTGGAACAGGG + Intronic
912237699 1:107869673-107869695 CTGTGGGAACAGGTGGTATTTGG + Intronic
913445356 1:118944832-118944854 CTGTGAGATGTGCTGGAACATGG - Intronic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
915977434 1:160400469-160400491 CTGTGGGAACAGCCGGGAGGCGG + Intergenic
917340509 1:173972591-173972613 ACTTGGGAACAGCTGGAAAATGG - Exonic
918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG + Intergenic
918937207 1:190937089-190937111 CTGTAGAAATAGCTGGATCATGG + Intergenic
919320257 1:196027524-196027546 TTATGGTAGCAGCTGGAACAGGG - Intergenic
921047109 1:211485394-211485416 CTGGGGGAGCAGCTGGCACTGGG - Intronic
924757146 1:246951733-246951755 CTGTGGGAACTGCTGAGACCTGG + Intronic
1062919764 10:1271034-1271056 CTGTGTGACCAGCTGGGATATGG + Exonic
1068561659 10:58521583-58521605 CTGTGGGAACCGCAGGTATAAGG - Intronic
1069515099 10:69070986-69071008 CTGTGTGAAGACCTGGAACGTGG - Intergenic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1069972295 10:72182342-72182364 CTGAGGGAAGAGCTGGAAATTGG - Intronic
1072871878 10:99128628-99128650 CAGTGAGAACACCTGGAACAGGG + Intronic
1073480251 10:103782019-103782041 CTCTGGGAAGTGCTGCAACAGGG + Intronic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1075087296 10:119422160-119422182 CCCTGGGAACAGCTGGCAGAGGG + Intronic
1075260328 10:120958033-120958055 CTGGGGGAGCAGTTGGTACAGGG + Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077155285 11:1088350-1088372 CTTCGGGAACAGCTGGAAGGAGG + Intergenic
1077207087 11:1349892-1349914 CTCTGGGAACAGCTGGGGAAAGG - Intergenic
1077269108 11:1666679-1666701 CTGTGGGAATATCTGTGACACGG - Intergenic
1077271439 11:1684035-1684057 CTGTGGGAATATCTGTGACACGG + Intergenic
1077414591 11:2418810-2418832 TTGTGGCAACAGCTGGCATATGG + Intronic
1079248591 11:18771297-18771319 CTGAGGGAACAGCACAAACAAGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080774290 11:35371323-35371345 CTGAGGGTCCAGCTGGACCATGG - Intronic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1084012515 11:66360537-66360559 CTGTCGGCAGAGCTGTAACAGGG + Intronic
1085689988 11:78656832-78656854 CTCTGCGATCAGCTGGTACATGG + Exonic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1088101146 11:106157125-106157147 TTCTGGGAACAGCTGGAAACTGG + Intergenic
1088923757 11:114280684-114280706 CTTTGGGAAAAGGAGGAACAAGG + Intronic
1089064787 11:115654239-115654261 CTAGGAGAACAGCTGGGACAGGG + Intergenic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097824136 12:64157221-64157243 CTGTAGGAAGAGCTGAAGCAGGG + Exonic
1100888073 12:99094601-99094623 CTGTGAGAAGAGCTGTTACAAGG + Intronic
1101542082 12:105674512-105674534 CCGTGGGTGAAGCTGGAACAGGG - Intergenic
1101856380 12:108446799-108446821 TTTTGGGAACAGCTGGATCCAGG + Intergenic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1103479302 12:121240922-121240944 ATGTGGGAGCAGCTGGCTCAGGG - Intronic
1104299387 12:127550483-127550505 CTGTGGGAACACCTAGGGCAGGG + Intergenic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1104919334 12:132282505-132282527 TTTTGGGAACAGCTGGATCTAGG + Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1107284660 13:38777805-38777827 CTGTGGGAAAAACTGGAAAAGGG - Intronic
1108030192 13:46221116-46221138 CTATGTGTACAGCTGGCACATGG + Intronic
1110534621 13:76637051-76637073 ATGTGGGAACAGCTGAGATATGG - Intergenic
1113913918 13:113859977-113859999 CTTTGGGAACAGCTGGGGAAGGG - Intronic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1117256285 14:53981254-53981276 ATGTGTGAACACCTAGAACAAGG + Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118590404 14:67396670-67396692 ATGTGGGCAAAGATGGAACAAGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1122605256 14:102943842-102943864 CGGTGGGAAAAGCAGCAACAGGG + Intronic
1122825118 14:104367044-104367066 CTCTGGGCACAGCTGGCTCAGGG + Intergenic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1123701664 15:22918653-22918675 GTGTGGGCACAGCGGGCACAGGG + Intronic
1124013633 15:25859262-25859284 CTGAGTGTCCAGCTGGAACAGGG - Intronic
1124323358 15:28734658-28734680 CTGGGGCAACAGCTATAACATGG + Intronic
1125748558 15:42013442-42013464 CCGAGGGAACAGCATGAACAAGG + Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127651081 15:61008388-61008410 TTGTGGGTGCAGCTGGAATATGG - Intronic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1129322823 15:74784037-74784059 TTGTGGCCACAGCAGGAACAGGG + Intronic
1131327792 15:91465739-91465761 GTGTGAGGATAGCTGGAACAGGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1132297841 15:100755352-100755374 CTTTGTGAACAAATGGAACAAGG + Intergenic
1132514505 16:359939-359961 GTGAGGGAACAGCAGGGACAAGG - Intergenic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1133143943 16:3769775-3769797 CTGTGTGAACGGTAGGAACACGG + Intronic
1133676224 16:8075472-8075494 CTGGGGGAACATATGGAACTAGG - Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134851145 16:17480004-17480026 ATTTGGGAAGAGCTGGAACCAGG + Intergenic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1137762845 16:50954542-50954564 CTCTGGGAACATCAGGAACTCGG + Intergenic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1138514150 16:57526715-57526737 CTGTGGGAGAAGCTGGAACAGGG - Intronic
1141623548 16:85249682-85249704 CTGCGGGGACAGCTGGACAACGG - Intergenic
1143419711 17:6779216-6779238 CAGTGGGAAGTGCTGGATCAAGG - Intronic
1143471418 17:7178223-7178245 GTGTGGGAACAGCTGGAAGCTGG - Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144177165 17:12718405-12718427 CTGAGGGAACAGCCTGCACAAGG + Intronic
1144834378 17:18149219-18149241 GTTTGGGAACAGCTGGGACTCGG + Exonic
1145312999 17:21710625-21710647 CTGTGGCAGCACCTGGCACAGGG + Intergenic
1147700184 17:42388696-42388718 CTGTCGGAACAGCCAGCACAGGG - Intergenic
1147935918 17:44011046-44011068 CTGTGGGAAATCTTGGAACAGGG + Intergenic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149314388 17:55424796-55424818 CTGGGAGAACAGCTTGAACAAGG + Intergenic
1149349059 17:55769012-55769034 CTTTGAGGACAGCTGCAACAGGG + Intronic
1149611130 17:57958282-57958304 CTGTGAGAACATCTGGAAAGAGG - Intergenic
1150605342 17:66685979-66686001 CTGTGGGAACCACTGAATCAGGG + Intronic
1151392875 17:73799566-73799588 CTGTGGGCTCCCCTGGAACAGGG - Intergenic
1152365667 17:79854915-79854937 CTGTGGGATCAGCAGGGACTGGG + Intergenic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1156358730 18:36364984-36365006 ATCTGTGAACAGCTTGAACAAGG + Intronic
1157711930 18:49856152-49856174 CTCTGGTATCAGCTGGAACCAGG + Intronic
1157731997 18:50011904-50011926 CTCTGGGAACAGCTCGTGCAGGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160005156 18:75063834-75063856 CTGTGGGAACATCTGGATCTCGG - Exonic
1160307112 18:77750216-77750238 CAGTGGTTACAGCTGGAAAAAGG + Intergenic
1160628253 18:80228172-80228194 CTCTGAGCACAGCTGGAAAAGGG + Intronic
1161944089 19:7423748-7423770 CTTTGGCATCAGGTGGAACACGG - Intronic
1161979034 19:7621014-7621036 CTGTGCGTACAGCAGGTACAAGG + Exonic
1162326885 19:10004666-10004688 TTGTGGGAAGAGCTGGTACTGGG + Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1163311064 19:16514836-16514858 CTGTGGCAAAAGCTGGTACAGGG + Intronic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164398776 19:27888588-27888610 CAGTGAGAACATCTGCAACATGG + Intergenic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164645899 19:29858613-29858635 CTCTGGGAGCAGCAGGACCAGGG + Intergenic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165008220 19:32823676-32823698 GTGTGGGAACCACTGGAAAAGGG + Intronic
1165137883 19:33681831-33681853 CAGTGGAAGCAGCTTGAACAAGG - Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1168550680 19:57290767-57290789 CTCCAGGAACAGCTGGCACAGGG + Exonic
1168636407 19:58000537-58000559 CTCTGTGCAGAGCTGGAACAAGG - Intronic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
927195484 2:20543504-20543526 TTGAGGGAGCAGCTGGTACAGGG + Intergenic
927641533 2:24848688-24848710 CTGTAGGAAAAGCTGGACTATGG - Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
932093068 2:68823931-68823953 ATATGGGAACAGCTGGATCAAGG - Intronic
933006328 2:77000201-77000223 CTGTGGGGACAGCTGGACACAGG + Intronic
934628862 2:95892927-95892949 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629269 2:95898536-95898558 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629684 2:95904152-95904174 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934630095 2:95909764-95909786 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
934803825 2:97197375-97197397 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934804243 2:97202980-97203002 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934832816 2:97548798-97548820 CTGCAGGAACTGCTGGAAGAAGG - Intronic
935457722 2:103289485-103289507 CTGTGGGAACAGCTTGGAGGTGG - Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935693851 2:105753674-105753696 CTGTTGGAATAGCTTGCACAAGG + Intronic
936231975 2:110710743-110710765 CTGTGGGAGGAGGTGGAACTGGG + Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938070303 2:128304931-128304953 CTGTGGCAACCCATGGAACATGG + Intronic
938107932 2:128545961-128545983 CTGTGGAAAAAACAGGAACAGGG + Intergenic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
941031706 2:160519158-160519180 CTGTGGGAAAAGTTGGGAGAGGG - Intergenic
941748918 2:169115222-169115244 CTGTTGGAAGAACTGGAACAAGG + Intergenic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
947498971 2:230658690-230658712 CTTTGGGAAGAGCTTGAAGAGGG - Intergenic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169949668 20:11029845-11029867 CTGTGGGAACTTCTGCATCATGG - Intergenic
1170853216 20:20022916-20022938 CTGTGGCAACATCTGGAACAAGG - Intronic
1171205493 20:23276152-23276174 ATGCGGGAACAGCTGGATGATGG - Intergenic
1171296155 20:24018963-24018985 CTGTGAGAGCAGCTGCCACAAGG - Intergenic
1172175832 20:32971203-32971225 CTGAGGGCTCAGCTGGGACAGGG + Intergenic
1172883547 20:38217050-38217072 CTGGGGGCACAGCAGGGACAGGG - Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174311634 20:49660269-49660291 CTTTGGTAACAGGTGGAACAGGG - Intronic
1174519633 20:51119567-51119589 CTAGGGGAAGGGCTGGAACATGG - Intergenic
1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG + Exonic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1179112565 21:38460126-38460148 CCTTGGCAACAGCTAGAACAAGG + Intronic
1179227637 21:39469167-39469189 GTGTGGGAACAGGGGGTACATGG - Intronic
1179524109 21:41964508-41964530 CTCTGGGACCAGCTGCAAGAAGG + Intergenic
1180129415 21:45817505-45817527 CTGCGGCAGCAGCTGGAATATGG - Intronic
1180154267 21:45970618-45970640 GTGAGGGAGCAGCTGGAACAGGG - Intergenic
1180749331 22:18113502-18113524 AGGTGGGAACATCTGCAACACGG + Intronic
1180802498 22:18638399-18638421 GGGTGGGGACTGCTGGAACAAGG + Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180853733 22:19033955-19033977 GGGTGGGGACTGCTGGAACAAGG + Intergenic
1180913904 22:19472176-19472198 CTGTGGGAAGAGCTGGCAGGAGG + Intronic
1181219225 22:21356862-21356884 GGGTGGGGACTGCTGGAACAAGG - Intergenic
1181848920 22:25735852-25735874 CTGCAGGAACAGCTGGCTCAAGG - Intergenic
1181884483 22:26009349-26009371 CTGGGGGAAGAACTGAAACAAGG - Intronic
1182855574 22:33514926-33514948 CTGTGTGAACAGCATGAACCAGG + Intronic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1183865222 22:40699003-40699025 CTGTGGGAACTTCTGGAAAAAGG + Intergenic
1184033714 22:41909051-41909073 ATGGGGGAAAAGCTGGAGCAGGG - Intergenic
1184794767 22:46725555-46725577 CTGTGGGAACATCTTGCAAAGGG + Intronic
1184808513 22:46812332-46812354 CTGTGGGCACAGCAGGCACAAGG + Intronic
1185032434 22:48451488-48451510 TAGTGGGAACAGCGGAAACAGGG + Intergenic
949184976 3:1179508-1179530 CTGTGGGAAACACTGGAACACGG - Intronic
950520619 3:13495712-13495734 AGGTGGGTGCAGCTGGAACAGGG - Intronic
950583155 3:13876172-13876194 CTGTGGGAAGATCTGGAGAAGGG + Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951372158 3:21862768-21862790 CTGTGGCAGCAGATGTAACAGGG - Intronic
952007389 3:28857700-28857722 CTCTGGGAAAAGCTACAACATGG - Intergenic
952082351 3:29774734-29774756 ATGTGGCAAAAGCTGGAATATGG + Intronic
953534735 3:43769170-43769192 CCCTGGGTACAGCTGGCACATGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954070835 3:48141718-48141740 CTGTGGGGACAGCTGCTTCATGG + Intergenic
954330946 3:49890020-49890042 CTGTGGGAACTGCTGACACGGGG - Exonic
955798170 3:62659433-62659455 CTGAGGGAAAAGCAGGTACATGG + Intronic
956642923 3:71431588-71431610 GTGTGGGACCAGATGGACCAGGG - Intronic
957516925 3:81267134-81267156 CTAGGGGAACAACTGGTACAAGG - Intergenic
959029748 3:101284701-101284723 CTGTGTGCACAGCTAGGACAAGG - Intronic
961303279 3:125936089-125936111 CGGTGGGCAGAGCTGGGACATGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961662537 3:128477332-128477354 CTGTGGCAACAGCTGGCAAGAGG + Intergenic
968909748 4:3471599-3471621 GTGTGGGAACAGCATGAACACGG - Intronic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
971640553 4:29126570-29126592 GTGTGGGAACAGATGAAAAATGG + Intergenic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
974014598 4:56637443-56637465 GTGTGGTAACTGCTGTAACATGG + Intergenic
974980120 4:68945408-68945430 CTGTGGGAAAAGCTGAGATATGG - Exonic
976106775 4:81627484-81627506 CTGTGGTCTCAGCTGGAACTTGG - Intronic
976130570 4:81879603-81879625 CTGTGGGAACAGATCCTACAAGG - Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
982961871 4:161849296-161849318 CTGTGGTATCAGTTGGTACAAGG + Intronic
987381357 5:17288855-17288877 CAGAGGGAACAGCTGGACAAAGG + Intergenic
987544473 5:19295138-19295160 ATGAGGAAACAGCTGGTACATGG - Intergenic
988834979 5:35023271-35023293 ACGTGGGAACAGCAGCAACAGGG + Intronic
992173852 5:74130408-74130430 CTGGGAGAACAGCTGAAACGTGG - Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993535962 5:89087016-89087038 CTGTGGGAAAAGTCTGAACATGG - Intergenic
993550932 5:89273033-89273055 GTCTGGGAGCAGCAGGAACATGG - Intergenic
995060426 5:107807146-107807168 CAGAGGAAACAGCTAGAACAAGG + Intergenic
996712688 5:126559261-126559283 CTGTGGGAACAGCTGGCCAGAGG - Exonic
998041639 5:138954309-138954331 CTGTGGGTACGGCAGGACCATGG + Intronic
998131125 5:139651459-139651481 CAGTGGGAACCCATGGAACATGG - Intronic
999111549 5:149125733-149125755 CTGTGAGGAAAGCTGGAACATGG + Intergenic
999227907 5:150042514-150042536 CAGAGGGAACAGCTCGAACAGGG + Intronic
999423326 5:151464198-151464220 CTGTGGGAAGAGCTGGGCTAAGG - Intronic
1000581086 5:163035898-163035920 CTGTGGAAACAGCTGGGAAGGGG + Intergenic
1001969972 5:175947651-175947673 CTGAGGGAACAACAGGAGCAGGG - Intronic
1002247465 5:177896113-177896135 CTGAGGGAACAACAGGAGCAGGG + Intergenic
1003816788 6:9850954-9850976 TTGTGGGAACACCTGTAACTAGG - Intronic
1004162555 6:13227832-13227854 CTGTGGTAAGAAGTGGAACAGGG - Exonic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1005962556 6:30704337-30704359 CTGTGGGGACAACTGGCTCAGGG + Exonic
1005962763 6:30705321-30705343 CTGTGGGCACAACTGGTTCAGGG + Exonic
1005962787 6:30705444-30705466 CTGTGGGGACAACTGGTTCAGGG + Exonic
1005962836 6:30705690-30705712 CTGTGGGGACAACTGGTTCAGGG + Exonic
1006055119 6:31378472-31378494 CTGTAGGACCAGCAGGAACACGG + Intergenic
1006112608 6:31757637-31757659 CTGTGAGCACATCTGGGACAGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006450800 6:34104710-34104732 GTGGGGAAACACCTGGAACAGGG - Intronic
1007631541 6:43275777-43275799 GTGTGGGAAGAGCTGGAAATGGG - Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1008640549 6:53458139-53458161 CAGTGTCATCAGCTGGAACATGG + Intergenic
1011000826 6:82586503-82586525 CTTTGGGGTCAGTTGGAACAAGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012373622 6:98534999-98535021 CTGTGGGATCAGTTTGAACAGGG + Intergenic
1012694410 6:102359484-102359506 CAGTGGGAAGAACTGGACCATGG + Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1013007999 6:106092371-106092393 CTGTGGGAGCAGGTGAAGCAAGG + Intronic
1014329136 6:120037968-120037990 CTGTGGCAAGAACTGTAACATGG + Intergenic
1015028003 6:128560456-128560478 TTGGGGGAACAGCAGGAACCAGG + Intergenic
1016096596 6:140045207-140045229 CTGTAGGAACATTTGGATCAGGG - Intergenic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1017209044 6:151834831-151834853 CTGTGGCAGCACCTGGAACTTGG + Intronic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1018559400 6:165085791-165085813 CTGGGGGAAAAGATAGAACAGGG + Intergenic
1019255143 7:44872-44894 CTGTGGGAAGAGCTGCCACGGGG + Intergenic
1019257998 7:63883-63905 CCGTGGGAACTGCAGGAACCAGG + Intergenic
1019523326 7:1470117-1470139 CTGCGGGAACTGCTGGCCCAAGG + Intergenic
1019610216 7:1932812-1932834 CTGTCTGAACAACAGGAACATGG - Intronic
1019633434 7:2062624-2062646 CTGAGGGAGCGGCTGGAACCAGG + Intronic
1024251905 7:47511982-47512004 CCATGGGAACAGGTGGAACAAGG - Intronic
1026045506 7:66903418-66903440 CTGAGGCAACAGCTGGGACTGGG - Intergenic
1026908919 7:74081444-74081466 CTGTGGGCACAGCATCAACATGG + Intergenic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027636295 7:80679392-80679414 ATCTGGGAACAGTTGGAAAAAGG - Intergenic
1029512671 7:101006178-101006200 CCATGGGATCACCTGGAACAGGG - Intronic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030083962 7:105801618-105801640 CTGAGGGTACACCTGGCACATGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032668290 7:134060214-134060236 CTTTGGGAACTGCTGCAAAAAGG + Intronic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1034131860 7:148725920-148725942 CAGTGGGAACAACTAGAAAAAGG + Intronic
1037743827 8:21627975-21627997 CCATGGGAACAGCAGGGACATGG + Intergenic
1038207270 8:25478424-25478446 CTGTGTGAAAAACTGTAACAGGG - Intronic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1038596907 8:28895325-28895347 CTGTGGGTACTGCTGAAACAGGG + Intronic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1040538107 8:48327162-48327184 TTGTAGGAAGAGCTGGACCAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1043501851 8:80866358-80866380 CTGTGTGTACAGCAGGAACCTGG + Intronic
1044363446 8:91315474-91315496 GTGTGGGCACAAGTGGAACATGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1049284903 8:141769336-141769358 CTGAGGGAACAGCAGAAACCAGG - Intergenic
1049348990 8:142154076-142154098 CTGTGGGGAGAGCTGCAAGAGGG - Intergenic
1051183796 9:14438542-14438564 CTGTGGGGAAAGCTGGAAAGGGG + Intergenic
1053424574 9:38002713-38002735 CTGTTGGAAAAGCTTGAACTTGG - Intronic
1054796911 9:69310925-69310947 CAGCTGGAACAGCTGGAACCAGG + Intergenic
1056331484 9:85524635-85524657 CTGTGGGAACACCTGTAGGAAGG + Intergenic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1059283098 9:113151204-113151226 CATTGCCAACAGCTGGAACAGGG + Intronic
1059665447 9:116442297-116442319 CTAAGGGAACAGGAGGAACATGG - Intronic
1060523411 9:124307454-124307476 GTGGAGGAACCGCTGGAACAAGG - Intronic
1060542363 9:124439599-124439621 CTGGAGGAACAGCCGAAACATGG + Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060805380 9:126572509-126572531 CAGTGGGAGCAACTGGATCATGG - Intergenic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061621128 9:131811989-131812011 CTGTAGGACCCACTGGAACAGGG + Intergenic
1062094941 9:134698275-134698297 CTGTGGGAACAGCTGAGTCATGG + Intronic
1062130396 9:134889647-134889669 CTGTAGGACCAGCTGGTACTGGG + Intergenic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1186704578 X:12128019-12128041 CTGTGGAAACAGCTGGGAGGTGG - Intergenic
1187172852 X:16869473-16869495 AGGTGCGAACAGCTGTAACAGGG - Exonic
1187884677 X:23878367-23878389 CTGTGGCAACAGCTGTCACCAGG + Intronic
1189249698 X:39590917-39590939 CACTGGGGACAGCTGCAACATGG + Intergenic
1193430145 X:81392057-81392079 CTGGTGGAACAGCTGGGAGATGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195618387 X:106930514-106930536 TTGGGAGAGCAGCTGGAACATGG - Exonic
1196118215 X:112019850-112019872 CTGTTGGAAGGGCTGGAAAATGG + Intronic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1200833794 Y:7713046-7713068 CTGTGGAAACAGCTTCAAGATGG + Intergenic
1202624438 Y:56843003-56843025 CTGTGGGAACAGCGTAGACAAGG - Intergenic