ID: 1029715449

View in Genome Browser
Species Human (GRCh38)
Location 7:102322965-102322987
Sequence GCCTCCCACCCAGGATTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029715449_1029715458 18 Left 1029715449 7:102322965-102322987 CCGAGTAATCCTGGGTGGGAGGC No data
Right 1029715458 7:102323006-102323028 TCCCAAAGGGCTGTGATTATAGG No data
1029715449_1029715453 5 Left 1029715449 7:102322965-102322987 CCGAGTAATCCTGGGTGGGAGGC No data
Right 1029715453 7:102322993-102323015 ACCCACCTCAGCCTCCCAAAGGG 0: 120
1: 627
2: 1683
3: 3079
4: 5106
1029715449_1029715452 4 Left 1029715449 7:102322965-102322987 CCGAGTAATCCTGGGTGGGAGGC No data
Right 1029715452 7:102322992-102323014 CACCCACCTCAGCCTCCCAAAGG 0: 137
1: 587
2: 1338
3: 2281
4: 2852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029715449 Original CRISPR GCCTCCCACCCAGGATTACT CGG (reversed) Intergenic
No off target data available for this crispr