ID: 1029719507

View in Genome Browser
Species Human (GRCh38)
Location 7:102353834-102353856
Sequence TTGTGCTTCTAGAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029719500_1029719507 24 Left 1029719500 7:102353787-102353809 CCAAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1029719499_1029719507 25 Left 1029719499 7:102353786-102353808 CCCAAGTAGCTGGGATTACAGGT 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
Right 1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1029719501_1029719507 1 Left 1029719501 7:102353810-102353832 CCCACCAGAACGCCCAGCTCATT No data
Right 1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1029719503_1029719507 -3 Left 1029719503 7:102353814-102353836 CCAGAACGCCCAGCTCATTTTTG No data
Right 1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1029719497_1029719507 28 Left 1029719497 7:102353783-102353805 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1029719502_1029719507 0 Left 1029719502 7:102353811-102353833 CCACCAGAACGCCCAGCTCATTT No data
Right 1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029719507 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG Intergenic
Too many off-targets to display for this crispr