ID: 1029724163

View in Genome Browser
Species Human (GRCh38)
Location 7:102391091-102391113
Sequence TGACTCACACAGATGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 1, 3: 120, 4: 528}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724163_1029724170 20 Left 1029724163 7:102391091-102391113 CCCTGTCCCATCTGTGTGAGTCA 0: 1
1: 0
2: 1
3: 120
4: 528
Right 1029724170 7:102391134-102391156 CAGACCCAGGGCTAGACTGCTGG No data
1029724163_1029724171 21 Left 1029724163 7:102391091-102391113 CCCTGTCCCATCTGTGTGAGTCA 0: 1
1: 0
2: 1
3: 120
4: 528
Right 1029724171 7:102391135-102391157 AGACCCAGGGCTAGACTGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 188
1029724163_1029724169 8 Left 1029724163 7:102391091-102391113 CCCTGTCCCATCTGTGTGAGTCA 0: 1
1: 0
2: 1
3: 120
4: 528
Right 1029724169 7:102391122-102391144 CTCAGGCTGTCACAGACCCAGGG 0: 1
1: 0
2: 4
3: 19
4: 229
1029724163_1029724167 -9 Left 1029724163 7:102391091-102391113 CCCTGTCCCATCTGTGTGAGTCA 0: 1
1: 0
2: 1
3: 120
4: 528
Right 1029724167 7:102391105-102391127 TGTGAGTCACATAATCACTCAGG No data
1029724163_1029724168 7 Left 1029724163 7:102391091-102391113 CCCTGTCCCATCTGTGTGAGTCA 0: 1
1: 0
2: 1
3: 120
4: 528
Right 1029724168 7:102391121-102391143 ACTCAGGCTGTCACAGACCCAGG 0: 1
1: 0
2: 3
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724163 Original CRISPR TGACTCACACAGATGGGACA GGG (reversed) Intronic
900015217 1:144125-144147 AGACGCACACAGATGGGATTTGG - Intergenic
900045036 1:498957-498979 AGACCCACACAGATGGGATTTGG - Intergenic
900045484 1:502734-502756 AGACGCACACAGATGGGATTTGG - Intergenic
900066041 1:730456-730478 AGACCCACACAGATGGGATTTGG - Intergenic
900066835 1:737271-737293 AGACCCACACAGATGGGATTTGG - Intergenic
900067233 1:740687-740709 AGACCCACACAGATGGGATTTGG - Intergenic
900067684 1:744464-744486 AGACGCACACAGATGGGATTTGG - Intergenic
900847501 1:5115457-5115479 GGTCCCACACAGATGGGACGCGG - Intergenic
904711658 1:32434682-32434704 GGTCCCACAGAGATGGGACATGG - Intergenic
905060496 1:35135706-35135728 GGTCCCACACAGATGGGACGTGG + Intergenic
905212966 1:36386756-36386778 TGACTCACACCTCTGGGACAAGG - Intergenic
905499802 1:38427416-38427438 GGTCCCACACAGATGGAACACGG - Intergenic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
907292654 1:53426631-53426653 GGTCCCACACAGATGGGACGCGG - Intergenic
907521282 1:55024935-55024957 GGTCCCACACAGATGGGACGCGG - Intergenic
908591932 1:65645251-65645273 GGTCCCACACAGATGGGACGCGG + Intergenic
908782546 1:67704453-67704475 TCAATCACAAAGCTGGGACAAGG + Exonic
908852428 1:68388600-68388622 GGTCCCACACAGATGGGACGCGG - Intergenic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG + Intergenic
909550998 1:76898149-76898171 GGTCTCACACAGATGGGATACGG + Intronic
909788245 1:79642100-79642122 GGTCCCGCACAGATGGGACACGG + Intergenic
909909983 1:81247774-81247796 GGTCCCACACAGATGGGACGTGG - Intergenic
909910703 1:81254729-81254751 TGACCAACACAGTTAGGACATGG + Intergenic
909978429 1:82070891-82070913 GGTCCCACACAGATGGGACGTGG + Intergenic
911570416 1:99511954-99511976 GGTCCCACACAGATGGGACGTGG - Intergenic
911759759 1:101601410-101601432 GGTCCCGCACAGATGGGACATGG + Intergenic
912296494 1:108475286-108475308 GGTCCCGCACAGATGGGACACGG - Intergenic
913245149 1:116864437-116864459 GGTCCTACACAGATGGGACATGG - Intergenic
915283735 1:154839809-154839831 AGACAAACACAGACGGGACAAGG + Intronic
916244282 1:162671441-162671463 TAACTCACACATTTGGGACATGG - Intronic
916328880 1:163593356-163593378 GGTCCCGCACAGATGGGACAAGG - Intergenic
916941813 1:169685202-169685224 GGTCCCACACAGATGGAACATGG - Intronic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
917749676 1:178042312-178042334 GGTCCCGCACAGATGGGACATGG - Intergenic
919066722 1:192700858-192700880 AAACTCACACAGTTGGGAAATGG + Intergenic
920901507 1:210114188-210114210 GGTCCCTCACAGATGGGACATGG + Intronic
921212443 1:212911840-212911862 GGTCCCACACAGATGGGACGCGG - Intergenic
921459756 1:215413319-215413341 GGTCCCACACAGATGGGACGCGG + Intergenic
921520154 1:216147882-216147904 GGTCCCACACAGATGGGACGCGG - Intronic
922048435 1:221968290-221968312 GGTCCCGCACAGATGGGACACGG - Intergenic
922103047 1:222489859-222489881 AGACGCACACAGATGGGATTTGG - Intergenic
922263367 1:223962347-223962369 AGACGCACACAGATGGGATTTGG - Intergenic
922906418 1:229176754-229176776 GGTCCCACACAGATGGGACGCGG - Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923075230 1:230603564-230603586 GGTCCCGCACAGATGGGACATGG - Intergenic
923144897 1:231190900-231190922 TGACTCACAGGGATGAGAGAGGG - Intronic
923244779 1:232120513-232120535 GGTCCCACACAGATGGGACGCGG - Intergenic
923515524 1:234694916-234694938 TGTCTCAAACAGATGTGAGAAGG + Intergenic
923770715 1:236935630-236935652 GGTCCCGCACAGATGGGACATGG + Intergenic
923962809 1:239103705-239103727 GGTCCCGCACAGATGGGACATGG - Intergenic
924345208 1:243067361-243067383 AGACGCACACAGATGGGATTTGG - Intergenic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1064663791 10:17630221-17630243 GGTCCCGCACAGATGGGACACGG + Intergenic
1065443095 10:25772116-25772138 GGTCCCACACAGATGGGACGCGG + Intergenic
1066260521 10:33725219-33725241 TGACTAAGACTGAAGGGACAAGG - Intergenic
1066666647 10:37789778-37789800 TGACTAACACAGATAGGGGAAGG + Intronic
1066731129 10:38437448-38437470 AGACGCACACAGATGGGATTTGG + Intergenic
1067213486 10:44281323-44281345 TGTCTCACACAGATGCCACGTGG - Intergenic
1067360428 10:45573547-45573569 GGTCCCGCACAGATGGGACAAGG - Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068230996 10:54169090-54169112 GGTCCCACACAGATGGGACGCGG - Intronic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1069914230 10:71777563-71777585 TGACTCAAACAGAAAGGGCAAGG - Intronic
1070112192 10:73496669-73496691 TGACTGACACTCATGGGAAAGGG + Intergenic
1070474949 10:76820904-76820926 GGTCCCACAGAGATGGGACACGG - Intergenic
1071114557 10:82202206-82202228 TGACTCACACACATGACACAGGG + Intronic
1071550769 10:86564614-86564636 GGTCCCGCACAGATGGGACATGG + Intergenic
1071897712 10:90084417-90084439 GGTCTTACACAGATGGGACGCGG + Intergenic
1071916226 10:90297340-90297362 GGTCCCACACAGATGGGACGCGG - Intergenic
1072580284 10:96734547-96734569 GGTCCCGCACAGATGGGACACGG - Intergenic
1073014039 10:100384080-100384102 GGTCTGGCACAGATGGGACATGG - Intergenic
1073920513 10:108452836-108452858 TGATTCATACACATGGGTCAGGG + Intergenic
1075248720 10:120847183-120847205 GGTCCCGCACAGATGGGACACGG - Intergenic
1075256942 10:120932842-120932864 AGACTCACACAGAGGGAAGAAGG + Intergenic
1076677594 10:132155462-132155484 TTCCTCACACAGAGGGGCCAGGG + Intronic
1076790254 10:132773303-132773325 TGACTCTCAGAGGTGGGAGAGGG + Intronic
1076971364 11:135448-135470 AGACCCACACAGATGGGATTTGG - Intergenic
1076971811 11:139225-139247 AGACGCACACAGATGGGATTTGG - Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1077612209 11:3650270-3650292 GGTCCCACACAGATGGGATACGG - Intronic
1077679046 11:4222622-4222644 GGTCTCGCACAGATGGGACACGG + Intergenic
1077688482 11:4319263-4319285 GGTCTCGCACAGATGGGACACGG + Intergenic
1079447483 11:20570123-20570145 GGTCCCACAGAGATGGGACATGG - Intergenic
1079668582 11:23136711-23136733 TGACTCTCACAGAGAGGAAATGG - Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1080467566 11:32512125-32512147 TGACTGACACAGGGTGGACAGGG - Intergenic
1081356830 11:42122910-42122932 GGTCCCACACAGATGGGACGCGG - Intergenic
1081536570 11:44001100-44001122 TGACTCCCATAGTTAGGACAGGG - Intergenic
1081773440 11:45663410-45663432 TGACTCACAGAGATGGCTCAGGG + Intronic
1083225520 11:61282055-61282077 TGACTCAGACAGCTGGGAGCGGG + Intronic
1084047189 11:66575953-66575975 GGTCCCACACAGGTGGGACACGG - Intergenic
1084245576 11:67854785-67854807 GGTCCCGCACAGATGGGACATGG + Intergenic
1084738253 11:71120187-71120209 TGAGTCTCACAGAGGGGACCTGG - Intronic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1085217855 11:74848187-74848209 TGTGTCACTCAGGTGGGACAGGG + Exonic
1085773400 11:79344247-79344269 TTACTCACACAGGTGGCAGAGGG + Intronic
1085988039 11:81808549-81808571 GGTCCCACACAGATGGGAAATGG - Intergenic
1086005044 11:82027555-82027577 GGTCCCGCACAGATGGGACATGG - Intergenic
1086125285 11:83343461-83343483 GATCCCACACAGATGGGACATGG + Intergenic
1086238927 11:84665564-84665586 TGACTCTCTGAGATGGGTCATGG - Intronic
1086514540 11:87596565-87596587 GGACACCCACAGATGGGAAAGGG + Intergenic
1087839517 11:102907456-102907478 GGTCCCACACAGATGGGACGCGG + Intergenic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090203861 11:124874390-124874412 TGCCTCTCACAGAAGAGACAAGG + Intronic
1090449488 11:126793587-126793609 TGACTCACACAGAGGAACCAAGG + Intronic
1091247683 11:134112688-134112710 TCACTCACACAGAGGTCACATGG + Intronic
1092592734 12:9966444-9966466 GGTCTTGCACAGATGGGACATGG + Intronic
1092626725 12:10336306-10336328 TGTCCTACACAGATGGGACGTGG + Intergenic
1092723698 12:11465547-11465569 GGTCCCACACAGATGGGACGCGG + Intronic
1092739301 12:11613072-11613094 GGTCCCGCACAGATGGGACATGG + Intergenic
1092789730 12:12060727-12060749 GGTCCCGCACAGATGGGACACGG - Intronic
1093002870 12:14017694-14017716 TGAATCACAAAGATGTGACTGGG + Intergenic
1093024355 12:14232914-14232936 GGTCCCGCACAGATGGGACACGG - Intergenic
1093071141 12:14708251-14708273 GGTCCCACACAGATGGGACGCGG + Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093290252 12:17310947-17310969 TTACTAATACAGAGGGGACAAGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093321963 12:17723652-17723674 GGTCCCACACAGATGGGACGTGG + Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1093792542 12:23270365-23270387 AGATTCACACAGATGGGTGATGG + Intergenic
1094316028 12:29138379-29138401 GGTCCCACACAGATGGGTCATGG + Intergenic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095251564 12:39985041-39985063 TTACTCACACATATGGGGGAGGG + Intronic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095735504 12:45552138-45552160 TGACTGTTACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1095999002 12:48113508-48113530 GGTCCCGCACAGATGGGACATGG + Intronic
1096116187 12:49056782-49056804 TGACTGGGACAGATGAGACAGGG + Intronic
1096176982 12:49528271-49528293 CCACCCAGACAGATGGGACAAGG + Intergenic
1096601166 12:52730706-52730728 TGATGGGCACAGATGGGACAAGG + Intergenic
1097316119 12:58173152-58173174 TGTCTCACACAGATGTGCAAAGG + Intergenic
1097398611 12:59104174-59104196 TGTCCCGCACAGATGGGACACGG - Intergenic
1097417031 12:59326596-59326618 GGTCCCACACAGATGGGACGTGG + Intergenic
1097542177 12:60955360-60955382 GGTCCCACACAGATGGGACGTGG + Intergenic
1098173618 12:67770025-67770047 GGTCCTACACAGATGGGACACGG + Intergenic
1098290493 12:68952949-68952971 AGAATCACACAGATAGGCCAGGG - Intronic
1098402274 12:70087735-70087757 GGTCCCACACAGATGGGACGCGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099292080 12:80786455-80786477 GGTCCCACACAGATGGGACGCGG + Intergenic
1099530080 12:83768009-83768031 TGAGGCACACAGATGTAACAAGG - Intergenic
1099762609 12:86941134-86941156 GGTCCCACACAGATGGGACGCGG - Intergenic
1100411793 12:94326187-94326209 TGGCTCACACAGAGAGGGCATGG + Intronic
1100940321 12:99717522-99717544 GGTCCCACACAGATGGGACGCGG - Intronic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1101278375 12:103226057-103226079 GGTCCCACACAGATGGGACGTGG + Intergenic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1103172752 12:118835661-118835683 GGAAACACACAGAAGGGACACGG + Intergenic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1106943463 13:34800978-34801000 GGTCCCGCACAGATGGGACACGG - Intergenic
1107075602 13:36318777-36318799 GGTCCCACACAGATGGGACGGGG - Intronic
1107220274 13:37972553-37972575 GGTCCCACACAGATGAGACACGG + Intergenic
1107683118 13:42870795-42870817 GGTCCCACACAGATAGGACACGG + Intergenic
1107861768 13:44667619-44667641 TGGCTCTCACAGATGGGGCAGGG + Intergenic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108513017 13:51172202-51172224 GGTCCCACACAGATGGGACGCGG - Intergenic
1108913397 13:55581622-55581644 GGTCCCACACAGATGGGACGCGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1108947457 13:56042646-56042668 GGTCCCACACAGATGGGACGTGG - Intergenic
1109343601 13:61090691-61090713 GGTCTTGCACAGATGGGACATGG - Intergenic
1109352936 13:61207122-61207144 GGTCTTGCACAGATGGGACATGG - Intergenic
1109716719 13:66229758-66229780 GGTCCCACACAGATGGGACGTGG + Intergenic
1110302018 13:73939763-73939785 TGACCCACACAGCTGGTACCAGG + Intronic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111302070 13:86360741-86360763 GGTCCCACACAGATGGGACGCGG - Intergenic
1111362084 13:87189804-87189826 GGTCCCACACAGATGGGATATGG + Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111630465 13:90841775-90841797 GGTCCCACACAGATGGGACGTGG - Intergenic
1112660241 13:101499650-101499672 TGACTCACACTAAAGGGACAGGG - Intronic
1112768396 13:102771522-102771544 TCACACACACAGATGGGGAAAGG - Intronic
1113233482 13:108241690-108241712 TGACACACACAGAGAGGAGAAGG + Intergenic
1113324359 13:109267683-109267705 GGTCCCGCACAGATGGGACATGG - Intergenic
1113571728 13:111362795-111362817 AGAGTCACACAGATGGGATGTGG + Intergenic
1114221699 14:20702918-20702940 GGTCCCGCACAGATGGGACATGG - Intergenic
1115240582 14:31248720-31248742 GGTCCCGCACAGATGGGACACGG + Intergenic
1116179702 14:41518278-41518300 GGTCCCACACAGATGGGACGCGG - Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1116702383 14:48258759-48258781 GGTCCCGCACAGATGGGACACGG + Intergenic
1117309642 14:54509053-54509075 TGACTCACAGGGTTGAGACAAGG + Intergenic
1117331810 14:54719861-54719883 TAACTAACACAGATGGGAGTAGG - Intronic
1118746799 14:68780163-68780185 TGACTCACACAGACGGGTTTGGG - Intergenic
1120359155 14:83474821-83474843 GGAATCACACCTATGGGACACGG - Intergenic
1121783378 14:96637001-96637023 AGACACACACAGAGGAGACATGG - Intergenic
1122041019 14:98987534-98987556 GGTCCCACACAGATGGGACGCGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1125045798 15:35241105-35241127 GGTCCCGCACAGATGGGACACGG - Intronic
1125213194 15:37239572-37239594 GGTCCCACACAGATGGGACGCGG + Intergenic
1125789833 15:42356316-42356338 AGACTGTCACAGATGTGACATGG - Exonic
1126764874 15:52001910-52001932 AGACTCTGACACATGGGACAGGG - Intronic
1126912383 15:53430209-53430231 GGTCCCGCACAGATGGGACATGG + Intergenic
1128789467 15:70422568-70422590 GGACTCAGAGAGATGAGACATGG + Intergenic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1130513474 15:84607838-84607860 TTTATCACAGAGATGGGACAAGG - Intronic
1131684203 15:94753109-94753131 GGACCTGCACAGATGGGACATGG - Intergenic
1131882493 15:96875201-96875223 GGTCCCACACAGATGGGACGTGG + Intergenic
1132340435 15:101074872-101074894 GGTCCCGCACAGATGGGACACGG - Intronic
1132510382 16:337987-338009 TTATTCTCACAGATGTGACACGG + Intronic
1132696884 16:1205975-1205997 TGCATCCCACAGATGGGAGAGGG - Intronic
1133460078 16:5979921-5979943 TCACTCACACAGGTAGGACGTGG + Intergenic
1133766742 16:8843456-8843478 GGTCCCGCACAGATGGGACACGG + Intronic
1133869521 16:9674490-9674512 GGTCCCACACAGATGGGACGTGG + Intronic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1136355337 16:29741578-29741600 TGAGTGATAGAGATGGGACAGGG + Intergenic
1136529975 16:30861492-30861514 GATCCCACACAGATGGGACACGG - Intronic
1137696314 16:50464508-50464530 GGACACACACAGCTGGTACATGG + Intergenic
1138759078 16:59521005-59521027 GGTCCCGCACAGATGGGACACGG + Intergenic
1138804971 16:60081168-60081190 GGTCACACACAGATGGGACGCGG - Intergenic
1138971443 16:62149022-62149044 TGACTCTCGCATATGGGATAGGG + Intergenic
1139225892 16:65233209-65233231 GGTCCCACACAGATGGGACGCGG + Intergenic
1139230576 16:65278626-65278648 GGTCCCACACAGATGGGACGCGG + Intergenic
1139943028 16:70619841-70619863 GGTCCCACACAGATGGGACGCGG + Intronic
1139943696 16:70624158-70624180 GGTCCCACACAGATGGGACGCGG + Intronic
1141604234 16:85143895-85143917 TGTCTCTCACAGATGGGCCACGG - Intergenic
1141865183 16:86745398-86745420 GGTCCCGCACAGATGGGACACGG + Intergenic
1142448436 16:90158297-90158319 AGACGCACACAGATGGGATTTGG + Intergenic
1142448887 16:90162074-90162096 AGACCCACACAGATGGGATTTGG + Intergenic
1142449289 16:90165493-90165515 AGACCCACACAGATGGGATTTGG + Intergenic
1142459049 17:76992-77014 AGACGCACACAGATGGGATTTGG - Intergenic
1143707903 17:8712405-8712427 AAAGTCACACAGATGGGACCAGG - Intergenic
1145080643 17:19891836-19891858 GGTCCCACACAGATGGGACGTGG + Intergenic
1146597921 17:34185610-34185632 GGTCCCACACAGATGGGACGCGG - Intergenic
1149220527 17:54411793-54411815 GGTCCCTCACAGATGGGACATGG - Intergenic
1149319589 17:55470135-55470157 GGACCTGCACAGATGGGACATGG - Intergenic
1151839732 17:76609328-76609350 GGTCCCGCACAGATGGGACACGG + Intergenic
1152276892 17:79363225-79363247 TGATGCACAGAGAGGGGACATGG + Intronic
1152497828 17:80686779-80686801 GGACTCACACAGCTGGGCGAGGG - Intronic
1153777051 18:8463495-8463517 TGAGTGAGCCAGATGGGACAGGG + Intergenic
1155696995 18:28696474-28696496 GGTCCCGCACAGATGGGACACGG + Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1156555026 18:38057628-38057650 AGACTAAGAAAGATGGGACATGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1159164487 18:64683977-64683999 GGTCCCGCACAGATGGGACATGG - Intergenic
1159835075 18:73326973-73326995 GGTCCCACACAGATGGGACGCGG - Intergenic
1160648768 19:209505-209527 AGACGCACACAGATGGGATTTGG - Intergenic
1161661743 19:5550807-5550829 GGTCCCACACAGATGGGACGCGG - Intergenic
1162262232 19:9542572-9542594 GGGGTCCCACAGATGGGACATGG - Intergenic
1163487312 19:17595765-17595787 GGTCCCACACAGATGGGATACGG - Intergenic
1163944431 19:20522454-20522476 GGTCCCGCACAGATGGGACATGG + Intergenic
1164080827 19:21860138-21860160 GGTCCCACACAGATGAGACAGGG - Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164459204 19:28433236-28433258 GGTCCCCCACAGATGGGACATGG + Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1166498917 19:43326876-43326898 GGTCCCACACAGATGGGACGCGG + Intergenic
1166695555 19:44849454-44849476 TGATGAACACAGAAGGGACAGGG + Intronic
1167046579 19:47053120-47053142 GGTCCCACACAGATGGGACGCGG + Intergenic
1167665180 19:50819468-50819490 GGATTCCCACAGAGGGGACAGGG + Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168051664 19:53833946-53833968 GGTCCCACACAGATGGGACGCGG - Intergenic
1168227965 19:55010157-55010179 GGTCCCGCACAGATGGGACACGG + Intergenic
1168327559 19:55545999-55546021 CGACCCACAGAGACGGGACAGGG - Intergenic
1168475973 19:56675551-56675573 TGACAAACATAGCTGGGACATGG - Intergenic
1168652455 19:58100350-58100372 TGGCTCACCCAGACGGTACATGG - Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925655807 2:6147023-6147045 TCACTCAAAGAGATGGGAGAGGG - Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
925900514 2:8506050-8506072 CGACCCACACAGAGAGGACAGGG - Intergenic
926815525 2:16795315-16795337 GGTCCCACACAGATGGGACGTGG + Intergenic
927439594 2:23103706-23103728 TTACTCACACAGTTGGCACCAGG - Intergenic
928770199 2:34696189-34696211 GGTCCCGCACAGATGGGACACGG - Intergenic
928857193 2:35815417-35815439 GGTCCCGCACAGATGGGACATGG - Intergenic
928928586 2:36601372-36601394 GGTCCCGCACAGATGGGACACGG - Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
929793043 2:45037809-45037831 GGTCCCGCACAGATGGGACATGG + Intergenic
929950983 2:46409274-46409296 TGACACACCCAGACGGGACCTGG - Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931026371 2:58116789-58116811 GGTCCCGCACAGATGGGACACGG + Intronic
931180408 2:59893857-59893879 TGACTCACACAGGTGGCATCTGG - Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932358798 2:71088417-71088439 GGTCCCGCACAGATGGGACACGG + Intergenic
932947643 2:76255509-76255531 ACACCCACACAGATGGTACAGGG - Intergenic
932973934 2:76577227-76577249 GGTCCCACACAGATGGGACGCGG + Intergenic
933079290 2:77967446-77967468 GGTCCCGCACAGATGGGACATGG - Intergenic
933137956 2:78760234-78760256 GGTCCCTCACAGATGGGACATGG - Intergenic
933552371 2:83792283-83792305 GGTCCCGCACAGATGGGACACGG + Intergenic
934026156 2:88003181-88003203 AGACTCACACAAAGGGAACAGGG - Intergenic
934126094 2:88892346-88892368 TCACTGACACAGATGGTACCAGG + Intergenic
934227957 2:90150288-90150310 GGTCCCGCACAGATGGGACACGG + Intergenic
934892891 2:98086533-98086555 TGAGACAGACAGAAGGGACAGGG - Intergenic
936883357 2:117281078-117281100 GGTCCCACACAGATGGGACGCGG - Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
939460716 2:142493212-142493234 GGACCCATACAGATGGGACATGG + Intergenic
940182962 2:150955376-150955398 GGTCCCACACCGATGGGACATGG - Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940508767 2:154586611-154586633 GGTCCCGCACAGATGGGACATGG + Intergenic
940530209 2:154869658-154869680 GGTCCCGCACAGATGGGACACGG - Intergenic
940725227 2:157329285-157329307 TGACTTACATAGTTGGGACAGGG + Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
940781266 2:157936638-157936660 TGACTCACCTAGATGGAAAAAGG + Intronic
941340421 2:164298192-164298214 GGTCCCGCACAGATGGGACACGG - Intergenic
943412910 2:187563852-187563874 GGTCCCACACAGTTGGGACACGG + Intronic
943421564 2:187673851-187673873 GGTCCCGCACAGATGGGACATGG + Intergenic
943835423 2:192509817-192509839 GGTCCTACACAGATGGGACATGG - Intergenic
944394162 2:199249262-199249284 GGTCCCACACAGATGGGACGCGG - Intergenic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945376123 2:209080408-209080430 GGTCCCACACAGATGGGACGCGG - Intergenic
945394325 2:209301560-209301582 GGTCCCACACAGATGGGACGCGG - Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
945938342 2:215924708-215924730 GGTCCCACACAGATGGGACGTGG - Intergenic
946150077 2:217758875-217758897 TGACTAACCCAGATGGTAAAGGG - Intergenic
946760709 2:222990434-222990456 TGACTTACACAGATGGCAGCAGG + Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
946871735 2:224091224-224091246 GGTCCCGCACAGATGGGACATGG + Intergenic
947576709 2:231281078-231281100 TTACTTGCACACATGGGACATGG - Intronic
948534729 2:238637421-238637443 TGACCCACAGATATGGCACAGGG + Intergenic
1168854914 20:1001851-1001873 AGACTCACCCAGAAGGGAGAGGG - Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1169447950 20:5688166-5688188 TGACTGACATAGATGGTACTTGG + Intergenic
1169666148 20:8038497-8038519 CCACTCACACAGAAGGCACAAGG - Intergenic
1170106256 20:12756209-12756231 GGTCCCACACAGATGGGACGCGG - Intergenic
1170680413 20:18520971-18520993 GGTCCCGCACAGATGGGACACGG + Intronic
1170820681 20:19754519-19754541 GGTCCCGCACAGATGGGACACGG + Intergenic
1173003973 20:39125577-39125599 TGACACAAACAGAAGGGAGAAGG - Intergenic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1174080087 20:47964695-47964717 GGACTCACACGGCAGGGACATGG + Intergenic
1174837601 20:53873074-53873096 TGACTCCAGCAGATGGAACAAGG - Intergenic
1175374601 20:58515459-58515481 TGACTCACTCAGATGAGATTTGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177100646 21:16894513-16894535 GATCCCACACAGATGGGACATGG - Intergenic
1177102696 21:16916325-16916347 GGTCCCGCACAGATGGGACATGG - Intergenic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1178793524 21:35722233-35722255 AGGCTAACACAGATGGGATAAGG - Intronic
1178924993 21:36767343-36767365 TGGCTCACACAGGAGGGACAGGG + Intronic
1179387579 21:40957287-40957309 GGTCCCACACAGATGGGACGTGG - Intergenic
1179914142 21:44465311-44465333 TGTCCCTCCCAGATGGGACAGGG + Intergenic
1182075560 22:27493186-27493208 TGACTAGCACAGATGGGATGTGG + Intergenic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
949343530 3:3054305-3054327 TGACTCAGTCAGAAGGAACAAGG + Intronic
950602825 3:14049962-14049984 TTCCTCACACAGATGTGACAAGG + Intronic
951332306 3:21381936-21381958 GGTCCCGCACAGATGGGACATGG + Intergenic
952663434 3:35877698-35877720 GGTCCCGCACAGATGGGACATGG + Intergenic
952895196 3:38074037-38074059 GTCCTTACACAGATGGGACATGG + Intronic
952896036 3:38079653-38079675 GGTCCCACACAGATGGGACGTGG + Intronic
952946604 3:38482133-38482155 ATACACACACAGCTGGGACATGG - Intronic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
954969244 3:54637856-54637878 GGTCCCACACAGATGGGACGCGG + Intronic
956519039 3:70083470-70083492 TGACTTATACAGATGGGATAAGG - Intergenic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
956714805 3:72069563-72069585 TGACTGTCACAGATGGGAAAGGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957734847 3:84191175-84191197 GGTCCCACACAGAAGGGACAAGG + Intergenic
957985709 3:87571693-87571715 GGTCCCGCACAGATGGGACATGG - Intergenic
958568946 3:95855045-95855067 TGCCTCACTCAGACAGGACAAGG - Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
959093520 3:101929052-101929074 TTACTCACACAGCTGGCACTTGG - Intergenic
959156311 3:102670427-102670449 TGATTCACAAAGATTTGACATGG - Intergenic
959288331 3:104443292-104443314 GGTCCCACACAGATGGGACGCGG + Intergenic
959411877 3:106034497-106034519 TGACTCACTCACCTGGCACAGGG + Intergenic
959972245 3:112420938-112420960 GGTCCCACACAGATGGGACGCGG + Intergenic
960282854 3:115796879-115796901 GGTCCCACACAGATGGGACGTGG + Intergenic
961164740 3:124755926-124755948 GGTCCCACACAGATGGGACGCGG + Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961380689 3:126494797-126494819 TGCCTCACACAGAATGGCCAGGG - Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961730607 3:128962042-128962064 GGTCCCGCACAGATGGGACACGG - Intronic
961893694 3:130150513-130150535 GGTCCCACACATATGGGACATGG + Intergenic
962205586 3:133431465-133431487 GGTCCCGCACAGATGGGACACGG - Intronic
962763350 3:138538643-138538665 TGACCCCCACAGATGGAAAAAGG + Intronic
963058644 3:141207300-141207322 GGTCCCGCACAGATGGGACATGG - Intergenic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963425240 3:145115316-145115338 GGTCCCACACAGATGGGATAAGG - Intergenic
963456645 3:145554549-145554571 GGTCTCGCACAGATGGGACACGG + Intergenic
963468632 3:145712734-145712756 GGTCCCACACAGATGGGATAAGG - Intergenic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963684352 3:148416684-148416706 GGTCCCACACAGATGGGACGTGG - Intergenic
964300233 3:155278556-155278578 GGTCCTACACAGATGGGACATGG + Intergenic
964906499 3:161725235-161725257 GGTCTTGCACAGATGGGACATGG + Intergenic
965624862 3:170675896-170675918 GGTCCCGCACAGATGGGACATGG + Intronic
965640019 3:170821332-170821354 GGTCCCGCACAGATGGGACATGG + Intronic
966085450 3:176063671-176063693 GGTCCCGCACAGATGGGACATGG - Intergenic
966105067 3:176324997-176325019 AGTCCTACACAGATGGGACACGG + Intergenic
966279324 3:178209868-178209890 GGTCCCACAGAGATGGGACAAGG - Intergenic
966397674 3:179519198-179519220 GGTCCCACACAGATGGCACATGG - Intergenic
966398429 3:179524307-179524329 GGTCCCACACAGATGGCACATGG + Intergenic
967005338 3:185377906-185377928 GGTCCCGCACAGATGGGACATGG + Intronic
967212146 3:187178903-187178925 GGTCCCACACAGATGGGACGCGG + Intronic
967302762 3:188031932-188031954 GGACTTAGACAGATGGGGCAGGG - Intergenic
967624632 3:191669862-191669884 GGTCCCGCACAGATGGGACACGG + Intergenic
967725966 3:192862727-192862749 GGACATACACAGATGGGAGATGG + Intronic
968079760 3:195837735-195837757 TGCCTCACGGAGATGGGGCATGG + Intergenic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
968369082 3:198210610-198210632 AGACGCACACAGATGGGATTTGG + Intergenic
969464281 4:7345619-7345641 TGCATCTCACAGATGGGAAACGG - Intronic
969749076 4:9096595-9096617 GGTCCCGCACAGATGGGACATGG - Intergenic
969962499 4:10959419-10959441 AGACTCACAGAGAGGGGAAAGGG + Intergenic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971180581 4:24325546-24325568 GGTCCCGCACAGATGGGACAAGG - Intergenic
971200156 4:24503343-24503365 CGTCCCGCACAGATGGGACACGG - Intergenic
972254538 4:37339183-37339205 TCACTCACATGGATGGGAGAAGG - Intronic
974428377 4:61767666-61767688 GGTCCCACACAGATGGGACGTGG + Intronic
976148339 4:82066516-82066538 TGACTAAGACAGATGGAACTGGG + Intergenic
976209256 4:82651129-82651151 TGTCTCACACAGATGGTAGTTGG + Intronic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
976915904 4:90374588-90374610 TACCTGACACATATGGGACAGGG - Intronic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977075185 4:92442339-92442361 GGTCCTACACAGATGGGACACGG + Intronic
977198411 4:94088002-94088024 GGTCCCGCACAGATGGGACACGG + Intergenic
977225325 4:94386846-94386868 GGTCCCGCACAGATGGGACATGG + Intergenic
978001100 4:103557141-103557163 GGTCCCACACAGATGGGACGTGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979027213 4:115592754-115592776 TGACTTACACAGTTGAGATAAGG + Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979850290 4:125565014-125565036 GGTCCCACACAGATGGGACGCGG + Intergenic
980111905 4:128644215-128644237 GGTCGCATACAGATGGGACACGG + Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982318827 4:154058613-154058635 GGTCCCACAAAGATGGGACATGG - Intergenic
982497089 4:156106844-156106866 GGTCCCGCACAGATGGGACACGG + Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983055507 4:163095421-163095443 GGTCCCGCACAGATGGGACACGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
983360425 4:166718633-166718655 GGTCCCACACAGATGGGACGCGG - Intergenic
983448075 4:167878584-167878606 GGTCCCGCACAGATGGGACACGG - Intergenic
983452353 4:167925227-167925249 GGTCCCACACAGATGGGACGTGG - Intergenic
983505001 4:168543646-168543668 TGACTCAGACTCTTGGGACAGGG - Intronic
984322208 4:178209455-178209477 GGTCCCATACAGATGGGACATGG - Intergenic
984393596 4:179168267-179168289 GGTCCCGCACAGATGGGACACGG + Intergenic
984437282 4:179722779-179722801 GGTCCCACACAGATGGGACGTGG - Intergenic
984700690 4:182816855-182816877 GGTCCCGCACAGATGGGACACGG - Intergenic
986193553 5:5517888-5517910 GGTCCCGCACAGATGGGACATGG - Intergenic
986388898 5:7265918-7265940 GGTCCCACACAGATGGGACGCGG - Intergenic
986905791 5:12492134-12492156 GGTCCCGCACAGATGGGACACGG - Intergenic
986919570 5:12665917-12665939 GGTCTCACACAGATGGGACGCGG + Intergenic
987498102 5:18672236-18672258 GGTCCCACACAGATGGGACGCGG + Intergenic
988199116 5:28047972-28047994 GGTCCCGCACAGATGGGACATGG - Intergenic
988361355 5:30240032-30240054 TGACTCCCACAGCAGGGCCAGGG + Intergenic
989106042 5:37864067-37864089 TGAAACACACAGTTGGGAAAAGG - Intergenic
989659945 5:43788447-43788469 GATCCCACACAGATGGGACATGG - Intergenic
989969454 5:50504960-50504982 TGACAAATACAGATGGGAAAAGG - Intergenic
990530240 5:56666450-56666472 TGACTCATACAGATGTGAGAAGG - Intergenic
990993444 5:61707702-61707724 TGAGTCACAGAGCTGGGAAATGG - Intronic
991475328 5:67012359-67012381 TGTCTCACACAGATGGAAACTGG + Intronic
991658575 5:68927738-68927760 AGACTCACACAGAAGAGAGAAGG - Intergenic
992451984 5:76883761-76883783 GGTCCCGCACAGATGGGACATGG + Intronic
993192732 5:84700812-84700834 GGTCCCACACAGATGGGACGTGG - Intergenic
994327846 5:98469676-98469698 TGACACAAACAAATGGGAAAAGG + Intergenic
994532528 5:100987632-100987654 GGTCCCACACAGATGGGACGTGG + Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994989572 5:106980713-106980735 GGTCCCGCACAGATGGGACACGG - Intergenic
995125143 5:108571834-108571856 GGTCTCGCACAGATGGGACACGG + Intergenic
995899349 5:117049742-117049764 GGTCCCGCACAGATGGGACATGG + Intergenic
996344802 5:122476982-122477004 GGTCCCACACAGATGGGATACGG + Intergenic
996912424 5:128670598-128670620 GGTCCCGCACAGATGGGACATGG + Intronic
996917701 5:128731879-128731901 GATCCCACACAGATGGGACATGG - Intronic
997678843 5:135735052-135735074 GGTCCCGCACAGATGGGACACGG + Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
998219434 5:140264541-140264563 TGAATCTCACAGAGGGGACTAGG + Intronic
998996380 5:147872350-147872372 GGTCCTACACAGATGGGACACGG + Intronic
999845051 5:155470157-155470179 TGCCTAACACTGATGGGACGGGG + Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001331433 5:170765411-170765433 GGTCCCGCACAGATGGGACACGG + Intronic
1001591068 5:172865747-172865769 TGAATCCCACAGATGGGACATGG - Intronic
1002728358 5:181316195-181316217 AGACGCACACAGATGGGATTTGG + Intergenic
1002728808 5:181319972-181319994 AGACCCACACAGATGGGATTTGG + Intergenic
1004106286 6:12669710-12669732 GGTCCCGCACAGATGGGACATGG - Intergenic
1005014638 6:21364885-21364907 GGTCCCACACAGATGGGACGTGG + Intergenic
1005886162 6:30099311-30099333 TGACACAGACACATGGGAGACGG + Intergenic
1006565823 6:34956315-34956337 TGACTCAAAGATATGAGACAAGG - Intronic
1007832692 6:44650905-44650927 TGTTTGTCACAGATGGGACAGGG + Intergenic
1008476547 6:51940516-51940538 GGTCCCACACAGATGGGGCATGG - Intronic
1009379162 6:63007646-63007668 GGTCCCACAGAGATGGGACATGG - Intergenic
1009750286 6:67872343-67872365 GGTCCCACATAGATGGGACATGG + Intergenic
1010071705 6:71751925-71751947 GGTCCCGCACAGATGGGACACGG + Intergenic
1010586677 6:77663933-77663955 GGTCCCACACAGATGGGACGCGG + Intergenic
1010662332 6:78585727-78585749 GGTCCCGCACAGATGGGACACGG - Intergenic
1010826894 6:80485815-80485837 GGTCCCGCACAGATGGGACACGG + Intergenic
1010841294 6:80651175-80651197 GGTCCCGCACAGATGGGACATGG + Intergenic
1010894527 6:81348515-81348537 GGTCCCGCACAGATGGGACACGG + Intergenic
1011367880 6:86601748-86601770 GGTCCCGCACAGATGGGACATGG + Intergenic
1011770922 6:90673590-90673612 GGTCCCACACAGATGGGACGTGG + Intergenic
1012066524 6:94557322-94557344 GGTCCCACACAGATGGGACGCGG + Intergenic
1012315844 6:97781931-97781953 GGTCCCACACAGATGGGACGCGG - Intergenic
1013353624 6:109328200-109328222 TGGCTGACACAGATGGGATGAGG - Intergenic
1013463763 6:110399821-110399843 TGCCTCAGACAGAAGGCACAGGG - Intronic
1014360140 6:120465644-120465666 GGTCCCACACAGATGGGACGTGG + Intergenic
1014555868 6:122842161-122842183 GGTCCCACACAGATGGGACGCGG - Intergenic
1014891562 6:126851086-126851108 GGTCCCGCACAGATGGGACATGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1015323850 6:131904018-131904040 GGTCCCACACAGATGGGACGCGG - Intergenic
1015607148 6:134969871-134969893 TGTCTCACACAGATTAGAGAGGG + Intronic
1016114122 6:140260788-140260810 GGTCCCACACAGATGGGACGTGG + Intergenic
1016518826 6:144925504-144925526 GGTCCCACACAGATGGGACGTGG - Intergenic
1016535741 6:145106527-145106549 GGTCCCACACAGATGGGACGCGG + Intergenic
1016650273 6:146453793-146453815 GGTCCCGCACAGATGGGACATGG + Intergenic
1017389522 6:153923817-153923839 GGTCCCACACAGATGGGACGCGG - Intergenic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1018495384 6:164342111-164342133 TGTCCCGCACAGATGGGACTCGG + Intergenic
1021393644 7:20122935-20122957 GGTCCCACACAGATGGGACGTGG - Intergenic
1021637335 7:22705576-22705598 GGTCCCGCACAGATGGGACACGG - Intergenic
1021810680 7:24398609-24398631 GGTCCCGCACAGATGGGACATGG - Intergenic
1021977877 7:26027565-26027587 GGTCCCGCACAGATGGGACATGG + Intergenic
1022318843 7:29268842-29268864 TGATTCACTCAAATGGGCCACGG + Intronic
1022372891 7:29787179-29787201 GGTCCCGCACAGATGGGACACGG - Intergenic
1022572773 7:31470405-31470427 GGTCCCGCACAGATGGGACATGG + Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1023320369 7:38990752-38990774 TGAATCACAGGGAGGGGACATGG + Intronic
1023399488 7:39781593-39781615 AGACCCACACAGATGGGATTTGG + Intergenic
1023698867 7:42873985-42874007 GGTCCCGCACAGATGGGACATGG + Intergenic
1024154867 7:46611173-46611195 TGACTAACACACATGTGCCAGGG - Intergenic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1025055086 7:55758688-55758710 AGACCCACACAGATGGGATTTGG - Intergenic
1025133158 7:56388914-56388936 AGACCCACACAGATGGGATTTGG - Intergenic
1025162034 7:56669629-56669651 TGACTCTCATAGATAGGACTAGG - Intergenic
1025184748 7:56849030-56849052 AGACGCACACAGATGGGATTTGG - Intergenic
1025185948 7:56858527-56858549 GGACCCACACAGATGGGATTTGG - Intergenic
1025685978 7:63718414-63718436 GGACCCACACAGATGGGATTTGG + Intergenic
1025687182 7:63727932-63727954 AGACGCACACAGATGGGATTTGG + Intergenic
1025908564 7:65809250-65809272 AGACTCACACAGATGGGATTTGG + Intergenic
1025910877 7:65827448-65827470 AGACCCACACAGATGGGATTTGG + Intergenic
1025912098 7:65837518-65837540 AGACTCACACAGATGGGATTTGG + Intergenic
1025977459 7:66380076-66380098 AGACCCACACAGATGGGATTTGG - Intronic
1025978873 7:66391681-66391703 GGACCCACACAGATGGGATTTGG - Intronic
1026520406 7:71112591-71112613 AGACTCTCACAGTTGGAACAAGG - Intergenic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1027203141 7:76075213-76075235 AGACCCACACAGATGGGATTTGG - Intergenic
1027471438 7:78579023-78579045 TGAGCCACACAGATGAGACATGG - Intronic
1028670529 7:93396263-93396285 GGTCCCACACAGATGGGTCACGG - Intergenic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1030468241 7:109930065-109930087 TAACTCTCACAGAGGGGAAATGG - Intergenic
1031004687 7:116457816-116457838 GGTCTCACACAGATGGGACGCGG - Intronic
1031368176 7:120929317-120929339 TGACTCACATCTATGGCACAGGG + Intergenic
1031525610 7:122819253-122819275 GGTCCCACACAGATGGGACGTGG - Intronic
1031727911 7:125262280-125262302 GGTCCCACACAGAAGGGACATGG + Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1032049820 7:128641084-128641106 AGACGCACACAGATGGGATTTGG + Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033088577 7:138364882-138364904 GGTCCCGCACAGATGGGACATGG - Intergenic
1033304548 7:140214829-140214851 TAACTCACGCCCATGGGACAGGG + Intergenic
1033695905 7:143788839-143788861 GGTCCCACACAGATGGGACGCGG - Intergenic
1034084813 7:148313428-148313450 GGTCCCGCACAGATGGGACATGG + Intronic
1034534492 7:151718516-151718538 TGACTTACAGAGCGGGGACACGG - Intronic
1036281501 8:7404768-7404790 GGTCCCACACAGATGGGACGCGG - Intergenic
1036372148 8:8170939-8170961 GGTCTCGCACAGATGGGACATGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1036878753 8:12494702-12494724 GGTCTCGCACAGATGGGACATGG + Intergenic
1037464057 8:19141550-19141572 TGACTCACACAGATGAGGTTGGG + Intergenic
1037467492 8:19174225-19174247 AGACTGACCCACATGGGACATGG + Intergenic
1037931791 8:22885336-22885358 AGAGTCACACAGATAGTACAGGG + Intronic
1039498983 8:38002055-38002077 GGCCCCGCACAGATGGGACATGG + Intergenic
1042809872 8:72812493-72812515 TGACTAACACAGATGACAAATGG + Intronic
1043353651 8:79389483-79389505 GGTCCCACACAGATGGGACGTGG + Intergenic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043598866 8:81915779-81915801 GATCCCACACAGATGGGACATGG - Intergenic
1043717879 8:83508519-83508541 GGTCCCGCACAGATGGGACACGG + Intergenic
1044258597 8:90093582-90093604 GGTCCCGCACAGATGGGACATGG + Intronic
1044417102 8:91950300-91950322 GGTCCCGCACAGATGGGACACGG - Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1044925179 8:97203251-97203273 GGTCCCACACAGATGGGACGCGG - Intergenic
1045197543 8:99946202-99946224 GGTCCCACACAGATGGGACGCGG - Intergenic
1045644801 8:104288266-104288288 GGTCCCACACAGATGGGACGCGG - Intergenic
1046386321 8:113512891-113512913 GGTCCCACACAGATGGGACGCGG + Intergenic
1046440032 8:114243669-114243691 GGTCCCACACAGATGGGACGCGG - Intergenic
1046512106 8:115214558-115214580 GGTCCCACACAGATGGGACGTGG - Intergenic
1047543409 8:125792578-125792600 TAACTAACACAGATGTCACAGGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1047829526 8:128615286-128615308 GGTCCCGCACAGATGGGACACGG + Intergenic
1048168415 8:132083615-132083637 GGTCCCACACAGATGGGACGCGG + Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049868799 8:144957637-144957659 GGTCCCGCACAGATGGGACATGG + Intergenic
1050258086 9:3814529-3814551 GGTCCCACAAAGATGGGACATGG + Intergenic
1051032751 9:12702080-12702102 TGATTCAAAGAAATGGGACATGG + Intronic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1051651857 9:19334426-19334448 TTACTCAAACAAATGGAACATGG + Intronic
1051715376 9:19977604-19977626 TGCCTGACACACATGGGAAAGGG - Intergenic
1051849267 9:21489079-21489101 GGTCCCGCACAGATGGGACACGG + Intergenic
1052163102 9:25290005-25290027 GGTCCCACACAGATGGGACGTGG - Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053078443 9:35154610-35154632 GGTCTCATACAGATGGGACACGG + Intergenic
1053758410 9:41332777-41332799 GGCCTCACACAGCTGGGCCATGG - Intergenic
1054822057 9:69532473-69532495 TAACACACACAGATGTCACAGGG - Intronic
1055233082 9:74087996-74088018 GGTCCCACACAGATGGGACGCGG - Intergenic
1055347697 9:75355158-75355180 GGTCCCGCACAGATGGGACACGG + Intergenic
1055626741 9:78183140-78183162 GGTCCCGCACAGATGGGACACGG - Intergenic
1055810067 9:80139744-80139766 GGTCCCACACAGATGGGACGTGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056363729 9:85883018-85883040 TGTCCCGCACAGATGGGACATGG - Intergenic
1056522466 9:87413259-87413281 GGTCCCACACAGATGGGACGCGG - Intergenic
1056804854 9:89720724-89720746 AGATTCACAGAGATGGGAAATGG - Intergenic
1056882999 9:90414908-90414930 GGTCCCACACAGATGGGACGTGG - Intergenic
1057234867 9:93349938-93349960 GGTCCCACACAGATGGGACGTGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057692211 9:97295265-97295287 AGACTCAAACACATGGGATATGG - Intergenic
1057953517 9:99388555-99388577 TGAGTCAGAAACATGGGACAAGG - Intergenic
1057982101 9:99672492-99672514 GGTCCCACATAGATGGGACATGG - Intergenic
1058026188 9:100144071-100144093 GGTCCTACACAGATGGGACACGG + Intronic
1058648531 9:107153500-107153522 TGACTCACTCAGATGGCTCTCGG - Intergenic
1059491391 9:114670439-114670461 GGACTCACACAGGTGGGAGGGGG - Intergenic
1059606687 9:115842582-115842604 GGTCCCACACAGATGGGACGCGG + Intergenic
1059754794 9:117282446-117282468 TGGCCCACACTAATGGGACAGGG + Intronic
1059863467 9:118489051-118489073 GGTCCCACACAGATGGGACGCGG + Intergenic
1060654021 9:125356265-125356287 TGACTCAAACAGATGTCAAATGG - Intronic
1060737860 9:126078005-126078027 GGTCCCCCACAGATGGGACACGG + Intergenic
1061583090 9:131549419-131549441 GGTCCCGCACAGATGGGACATGG - Intergenic
1061658984 9:132115549-132115571 TGGCTCTCACAGAAAGGACATGG + Intergenic
1062753423 9:138273294-138273316 AGACGCACACAGATGGGATTTGG + Intergenic
1203575934 Un_KI270745v1:8073-8095 AGACGCACACAGATGGGATTTGG + Intergenic
1203576385 Un_KI270745v1:11850-11872 AGACCCACACAGATGGGATTTGG + Intergenic
1185858410 X:3556501-3556523 GGTCCCGCACAGATGGGACACGG + Intergenic
1185960672 X:4543861-4543883 GGTCCCGCACAGATGGGACACGG + Intergenic
1185991079 X:4893925-4893947 GGTCCCGCACAGATGGGACACGG - Intergenic
1186293409 X:8123395-8123417 TGACCTACACATATGGAACATGG - Intergenic
1186529295 X:10279112-10279134 TGACTAATACAGATGGCAAATGG - Intergenic
1186784088 X:12942156-12942178 GGTCCCGCACAGATGGGACACGG - Intergenic
1187413345 X:19070161-19070183 TGAATCCCACAGAGGGGTCAAGG + Intronic
1188431044 X:30105677-30105699 GGTCCCACACAGATGGGACGCGG - Intergenic
1189031793 X:37459145-37459167 GGTCCCGCACAGATGGGACATGG + Intronic
1190736056 X:53256566-53256588 GGCCTCACACAGCTGGGACAGGG - Intronic
1192914114 X:75635642-75635664 GGTCCCACACAAATGGGACATGG + Intergenic
1193537114 X:82729194-82729216 AGTCCCACACAGAAGGGACATGG - Intergenic
1193885947 X:86984139-86984161 GGTCCCGCACAGATGGGACAAGG - Intergenic
1193941519 X:87684223-87684245 GGTCCCACACAGATGGGACGCGG - Intergenic
1194186230 X:90776694-90776716 GGTCCCGCACAGATGGGACACGG + Intergenic
1194293604 X:92103612-92103634 GGTCCCACACAGATGGGACGTGG + Intronic
1194502964 X:94702195-94702217 GGTCTCGCACAGATGGGACGCGG + Intergenic
1194873779 X:99162813-99162835 GGTCCCACACAGATGGGACGTGG + Intergenic
1195016931 X:100789796-100789818 GGTCCCGCACAGATGGGACATGG + Intergenic
1195291135 X:103432905-103432927 GGTCCCATACAGATGGGACACGG + Intergenic
1195750754 X:108160528-108160550 TGGCTCATCCCGATGGGACACGG + Exonic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1195908659 X:109868591-109868613 GGTCCCGCACAGATGGGACACGG + Intergenic
1196220963 X:113112094-113112116 GGTCCCGCACAGATGGGACATGG + Intergenic
1196330845 X:114469097-114469119 GGTCCCACACAGATGGGACGCGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1196535869 X:116843507-116843529 GAAGTCACACAGATGGTACATGG + Intergenic
1196572517 X:117281493-117281515 GGTCCCGCACAGATGGGACATGG - Intergenic
1196773836 X:119321141-119321163 GGTCCCGCACAGATGGGACATGG + Intergenic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198463289 X:136883115-136883137 GGACTAAGACAGATGGGAAAGGG + Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1200532820 Y:4358773-4358795 GGTCCCGCACAGATGGGACATGG + Intergenic
1200611123 Y:5328158-5328180 GGTCCCACACAGATGGGACGTGG + Intronic
1201070332 Y:10141793-10141815 TGACCCACACAGGTGTGGCAAGG - Intergenic
1201073838 Y:10172049-10172071 TGAGTCAAACAGATGGCAGAGGG - Intergenic