ID: 1029724910

View in Genome Browser
Species Human (GRCh38)
Location 7:102396421-102396443
Sequence GGTCGCACCGAGGAGGCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724910_1029724921 30 Left 1029724910 7:102396421-102396443 CCAGCCGCCTCCTCGGTGCGACC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724910_1029724920 27 Left 1029724910 7:102396421-102396443 CCAGCCGCCTCCTCGGTGCGACC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1029724920 7:102396471-102396493 GCTCGTCATCCCCAAGAATGCGG 0: 1
1: 0
2: 0
3: 10
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724910 Original CRISPR GGTCGCACCGAGGAGGCGGC TGG (reversed) Exonic
900658682 1:3772505-3772527 GGCCGCAGCGGGGAGGCGCCTGG - Intergenic
901622993 1:10604184-10604206 GGTGGCACAGAAGAGGCGACGGG + Intronic
901666182 1:10827628-10827650 GGACGAACCAAGGAGGGGGCTGG + Intergenic
902360155 1:15937946-15937968 GATCGCCCAGAGGATGCGGCTGG + Exonic
904613842 1:31739300-31739322 GGACTCACCTGGGAGGCGGCAGG + Exonic
914681943 1:149944686-149944708 GGTGGCAAGGAGGAGGCAGCTGG - Exonic
916151672 1:161798527-161798549 GCTTGAACCCAGGAGGCGGCAGG + Intronic
923069404 1:230549067-230549089 GGTGGCACCGAGGAGCTGTCCGG + Intergenic
924415366 1:243850922-243850944 GGATGCGCCGAGGAAGCGGCTGG - Intronic
1063463572 10:6229392-6229414 AGCCGCAGAGAGGAGGCGGCCGG - Intronic
1064540775 10:16403156-16403178 GGTTGAACCCAGGAGGCGGAGGG - Intergenic
1065596663 10:27319852-27319874 GGCCGCTCTGGGGAGGCGGCGGG + Intergenic
1067082472 10:43219367-43219389 GGTGCCACGGAGGAGGGGGCTGG + Intronic
1069384779 10:67874405-67874427 GGTGGCATGGTGGAGGCGGCTGG - Intergenic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1070752827 10:78973990-78974012 GGTCGCCGGGAGGTGGCGGCGGG - Intergenic
1073392720 10:103192919-103192941 GGTCCCAGCGAGCCGGCGGCTGG + Intronic
1076116966 10:127907450-127907472 GGGCGCGCCGCGGGGGCGGCGGG - Intronic
1077108162 11:850767-850789 GGCTGCACCGAGGAGGGAGCGGG - Intronic
1077279293 11:1734854-1734876 GGTCACATCGTGGAGGAGGCAGG + Exonic
1080458548 11:32435361-32435383 GATCGCGGCGAGGAGACGGCGGG + Exonic
1081593676 11:44444557-44444579 GGTCGCAGCCAAGAGGCTGCAGG + Intergenic
1083605298 11:63975041-63975063 CGGCGCAGCGAGGAGGCGACAGG - Intronic
1083656220 11:64230907-64230929 GGCCGCTCCGAGGAGCCGGGAGG - Exonic
1084370773 11:68741266-68741288 GGTGGCAGCGAGGAGGCCACTGG - Intronic
1085010915 11:73141526-73141548 GGCTGCACCGAGGGGGAGGCGGG - Intronic
1091173798 11:133541907-133541929 GCTCGCTCGGAGGAGGTGGCTGG + Intergenic
1091549947 12:1529982-1530004 GGGCGCCCCGAGGGGGCTGCTGG + Intronic
1094605827 12:31948319-31948341 GGTGGCATGGTGGAGGCGGCTGG - Intergenic
1101605997 12:106248006-106248028 GGCCGGGCCGAGGAGGCGGGAGG + Intronic
1101640104 12:106581520-106581542 GGGCGGACCGAGGGGGCGGGGGG + Intronic
1104568297 12:129903952-129903974 GGGCGGGCCGAGGCGGCGGCCGG - Intergenic
1104891796 12:132143816-132143838 GGGAGCAGCGAGGAGGCGCCGGG - Exonic
1104891807 12:132143852-132143874 GGGAGCAGCGAGGAGGCGCCAGG - Exonic
1104976621 12:132555038-132555060 GGTCGCCCCCAGCAGGGGGCAGG - Intronic
1106296330 13:28417396-28417418 GGCCGCACCAAGGAGGAGGTGGG - Intronic
1106868384 13:33992247-33992269 GCTTGGACCCAGGAGGCGGCGGG + Intergenic
1110119372 13:71864817-71864839 GCGCGCACGGAGGAGGCGGCGGG - Intronic
1117898387 14:60509998-60510020 GAGCGCACCGGGGAGGAGGCGGG + Intronic
1122564966 14:102647397-102647419 GGTTGAACCCAGGAGGCGGAGGG - Intronic
1202903154 14_GL000194v1_random:54619-54641 GGTCGCAGCGAGGAGGTGGACGG + Intergenic
1125999543 15:44195645-44195667 AGCCGGAGCGAGGAGGCGGCAGG + Intergenic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1129844655 15:78762683-78762705 GGAGGCACTGAGGGGGCGGCTGG - Intronic
1133085211 16:3356834-3356856 GGGCGCACTGAGGAGGTTGCTGG + Exonic
1133236724 16:4390837-4390859 AGTCGCAGCTAGGAGGCAGCAGG + Intronic
1136523748 16:30814533-30814555 GGCCGCACCGTGGATGGGGCGGG + Intergenic
1142811764 17:2398944-2398966 GGTCGCCCCGACTAGGCCGCCGG + Intronic
1142848789 17:2694558-2694580 GGTCTCACTGAGGAGGGAGCAGG + Exonic
1144854414 17:18260170-18260192 GCTCGCACAGAGCAGGTGGCAGG + Intergenic
1148021651 17:44557591-44557613 AGCCGCAGCGAGGAGGCGGCGGG + Exonic
1150373586 17:64662151-64662173 GGCGGCCGCGAGGAGGCGGCGGG - Intergenic
1152245467 17:79182824-79182846 GGGCGCGCAGAGGTGGCGGCGGG - Intronic
1160750826 19:733617-733639 GGGGGCACGGAGGAGCCGGCTGG + Intronic
1160948169 19:1652808-1652830 GGACGCGCAGAGGAGGCGGTCGG + Intergenic
1161570075 19:5025643-5025665 GGGAGCGCAGAGGAGGCGGCAGG - Intronic
1162566874 19:11449350-11449372 GGTGGCTCCGGGCAGGCGGCTGG - Exonic
1162769195 19:12938793-12938815 GGCCGCCCCGACGACGCGGCCGG + Intronic
1162778728 19:12995868-12995890 GGTCGCGCGGGGGCGGCGGCCGG - Intronic
1163314945 19:16535422-16535444 TGTCTGGCCGAGGAGGCGGCGGG + Intronic
1163442065 19:17327353-17327375 GGTGGCAGAGAGGAGGCTGCAGG + Intronic
1163529473 19:17841423-17841445 GGTGGCACCGCCGAGGCTGCTGG - Exonic
1163625497 19:18387026-18387048 GGTGGGACCCAGGAGGGGGCAGG + Intronic
1165958210 19:39515234-39515256 GTCCGCGCCGAGGAGGGGGCTGG - Exonic
1166092580 19:40519810-40519832 GTGCGCGCCCAGGAGGCGGCGGG + Exonic
1167463972 19:49640566-49640588 GGGCGCTCCGAGGAAGCAGCAGG + Intergenic
925933991 2:8735447-8735469 GCTTGCACCCAGGAGGCGGGAGG + Intronic
926980192 2:18560319-18560341 GCGCGCGCCGAGGAGGCGGCGGG - Exonic
927294967 2:21443599-21443621 GGTCACAGCCAGGAGGCAGCTGG + Intergenic
930872829 2:56184944-56184966 GGGTGCCCCGAGGAGGAGGCGGG + Intronic
934750923 2:96793575-96793597 GGTCTCAGAGAGGAGGCGGGGGG + Intronic
934768495 2:96893881-96893903 GGTGGCACCGTGGTGGAGGCAGG + Intronic
946391308 2:219418416-219418438 GGGCGCACGGAGGAGGCGGCGGG - Exonic
946737898 2:222772960-222772982 GGACGCAGGGAGAAGGCGGCCGG + Intergenic
946865691 2:224039385-224039407 GGCCACACAAAGGAGGCGGCGGG - Intergenic
948588968 2:239037519-239037541 AGTCGGAGAGAGGAGGCGGCTGG - Intergenic
1170885735 20:20338493-20338515 GGTGGCAAGGAGGAGGCGGGTGG - Intronic
1173860122 20:46277778-46277800 GGTTGTAACGAGGAGGGGGCGGG + Intronic
1174595303 20:51678898-51678920 GGTCTCACTGAGGATGAGGCTGG - Intronic
1175923186 20:62459391-62459413 GGGCCCTCCGAGGAGGAGGCTGG + Intergenic
1175997235 20:62817297-62817319 GGACCCATCGAGGACGCGGCCGG - Intronic
1176061602 20:63175140-63175162 GTGCGCACCGAGGCGGCCGCCGG + Intergenic
1176135532 20:63520614-63520636 AGTCGCACCGAGGTGGAAGCTGG + Intergenic
1176156904 20:63626673-63626695 GGGTCCACCGAGGAGGCCGCTGG + Intronic
1176622518 21:9069386-9069408 GGTCGCAGCGAGGAGGTGGATGG + Intergenic
1179297331 21:40075061-40075083 GGTTGTGCGGAGGAGGCGGCGGG - Exonic
1180042784 21:45288479-45288501 GGGGGCACCCAGGAGGCCGCAGG - Intergenic
1180413983 22:12692899-12692921 GGTGGCAGCTGGGAGGCGGCAGG + Intergenic
1182395195 22:30030619-30030641 GCTCTCAGCGAGGAGGGGGCGGG + Intronic
1183417455 22:37690806-37690828 GGTGGGACCGGGGAGGCAGCAGG - Intronic
1184731834 22:46374910-46374932 GGAAGCACCTGGGAGGCGGCGGG + Intronic
950198442 3:11026138-11026160 GGTGGCCCGGAGGAGGGGGCTGG - Intronic
950584008 3:13880156-13880178 GGGCGCTCCGGGGAGGCGGGCGG - Intergenic
953006283 3:38982254-38982276 GGTCCCACAGAGTAGGCAGCAGG - Intergenic
953447369 3:42979605-42979627 GAGCGCGCCGAGGAGCCGGCCGG + Exonic
953881681 3:46694208-46694230 GGTCGCACAGGAGGGGCGGCCGG - Intergenic
965666512 3:171099662-171099684 GGTAGCACAGAAGAGGGGGCAGG + Intronic
966854602 3:184185600-184185622 GGTCGCGGCGGGGAGGCGGGTGG + Intronic
966915766 3:184583485-184583507 GGCCGCGCGGAGGAGGCCGCGGG + Intronic
968508731 4:985412-985434 GGTTGCTCTCAGGAGGCGGCTGG + Intronic
968649579 4:1755178-1755200 GGTGGCACAGAGGAGGCGGTGGG - Intergenic
971207546 4:24584660-24584682 GGTCGGACCAATGAGGCAGCGGG - Intergenic
972265290 4:37453806-37453828 GCACGCCCCGAGGATGCGGCGGG - Intergenic
983904199 4:173168308-173168330 GGTCCAACGGAGGGGGCGGCGGG + Intergenic
986402884 5:7396336-7396358 GACCGCTCCGAGGAGGCGGCGGG + Exonic
992249776 5:74865899-74865921 GGTGGCGCCGAGGCGGAGGCCGG + Intronic
997292360 5:132747271-132747293 GCGCGCACCCAGGATGCGGCAGG - Intergenic
1001159375 5:169300450-169300472 GGTCCCACCGAGGGGGCCCCAGG - Intronic
1002534626 5:179869500-179869522 ACTCCCACCGAGGAGGCAGCTGG - Intronic
1004133351 6:12942574-12942596 GCTTGAACCCAGGAGGCGGCAGG + Intronic
1010980496 6:82364667-82364689 GGTGGCACCAGGGCGGCGGCAGG + Exonic
1011765036 6:90611122-90611144 GCGCGCGCGGAGGAGGCGGCCGG + Intergenic
1018188291 6:161286924-161286946 GGGAGCACCCAGGAGGCTGCGGG + Intergenic
1018921657 6:168179857-168179879 GGACGGGCCGAGGGGGCGGCAGG + Intergenic
1019270999 7:149205-149227 CGGCGCAATGAGGAGGCGGCCGG - Intergenic
1022012796 7:26323540-26323562 GGAGGCACCCAGGAGGCGGCAGG + Intronic
1023965811 7:44962603-44962625 GACCTGACCGAGGAGGCGGCCGG + Intergenic
1025174007 7:56787666-56787688 GGTCGCGGGGAGGAGGTGGCGGG - Intergenic
1025698094 7:63790289-63790311 GGTCGCGGGGAGGAGGTGGCGGG + Intergenic
1026981451 7:74529122-74529144 GGAAGCACCAAGGGGGCGGCAGG + Intronic
1027244657 7:76358934-76358956 GGCTGCGCGGAGGAGGCGGCTGG + Exonic
1029274428 7:99395828-99395850 GGTGGCACCGAGCAGGATGCGGG - Exonic
1029724910 7:102396421-102396443 GGTCGCACCGAGGAGGCGGCTGG - Exonic
1034982240 7:155486596-155486618 GGCAGCACCCAGGAGGAGGCTGG - Intronic
1035167215 7:156999133-156999155 GGCCGCACCCAGGAGGCTGAGGG - Intronic
1035169679 7:157010519-157010541 GCCCGCACGGAGGAGGCGCCGGG - Exonic
1036643923 8:10600703-10600725 GGCAGCACCGGGGAGGCGGAGGG - Intergenic
1039400117 8:37262238-37262260 GGTCTCACAGAGTAGGAGGCTGG - Intergenic
1041753574 8:61288299-61288321 GGATGGACCGCGGAGGCGGCGGG - Intronic
1045231185 8:100309437-100309459 GGTTGCCGCGGGGAGGCGGCGGG - Intronic
1051513674 9:17906734-17906756 GGTGGCTCCGCGGCGGCGGCCGG - Intergenic
1054870601 9:70044412-70044434 GGTCGCTCAGTGGAGGCGCCCGG + Intronic
1058058616 9:100473451-100473473 GGAGGCACCGAGGCAGCGGCGGG + Exonic
1062084437 9:134641599-134641621 AGTCGCAGCGAGGAAGGGGCTGG - Intergenic
1062341413 9:136095309-136095331 GGCCGCACCGCGGCGGGGGCGGG + Intergenic
1062620078 9:137416697-137416719 GGTCACACCGAGGTGGCACCAGG + Intronic
1203760799 EBV:12412-12434 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203760926 EBV:12776-12798 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203761728 EBV:15484-15506 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203761855 EBV:15848-15870 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203762657 EBV:18556-18578 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203762784 EBV:18920-18942 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203763586 EBV:21628-21650 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203763713 EBV:21992-22014 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203764515 EBV:24700-24722 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203764642 EBV:25064-25086 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203765444 EBV:27772-27794 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203765571 EBV:28136-28158 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203766373 EBV:30844-30866 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203766500 EBV:31208-31230 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203767302 EBV:33916-33938 GCTGGCCCCGAGGAGGCGCCCGG + Intergenic
1203767429 EBV:34280-34302 GCTGGCCCCGAGGAGGCGCCAGG - Intergenic
1203745712 Un_GL000218v1:39815-39837 GGTCACAGCGAGGAGGTGGACGG + Intergenic
1203564400 Un_KI270744v1:79665-79687 GGTCACAGCGAGGAGGTGGACGG - Intergenic
1188342568 X:29022239-29022261 GGTCACACCGAGGTGGTGACAGG - Intronic
1193601157 X:83509413-83509435 GGAGGAAGCGAGGAGGCGGCCGG + Exonic
1195649094 X:107266068-107266090 GCTTGAACCGAGGAGGCGGGAGG - Intergenic