ID: 1029724911

View in Genome Browser
Species Human (GRCh38)
Location 7:102396425-102396447
Sequence CGGTGGTCGCACCGAGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724911_1029724922 29 Left 1029724911 7:102396425-102396447 CCGCCTCCTCGGTGCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724911_1029724920 23 Left 1029724911 7:102396425-102396447 CCGCCTCCTCGGTGCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1029724920 7:102396471-102396493 GCTCGTCATCCCCAAGAATGCGG 0: 1
1: 0
2: 0
3: 10
4: 62
1029724911_1029724921 26 Left 1029724911 7:102396425-102396447 CCGCCTCCTCGGTGCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724911 Original CRISPR CGGTGGTCGCACCGAGGAGG CGG (reversed) Exonic
900145601 1:1157602-1157624 CGCTGGGCGCCCCGAGGAGGCGG + Intergenic
900962589 1:5934706-5934728 CCATGGTCACAGCGAGGAGGTGG + Intronic
901052513 1:6432397-6432419 CTGTGTCCGCACTGAGGAGGTGG + Intronic
901442177 1:9284982-9285004 CGGAGGTTGCAGTGAGGAGGAGG - Intergenic
902832735 1:19028301-19028323 CTGTGGGCACACTGAGGAGGGGG + Intergenic
904855846 1:33497701-33497723 CAGTGGTGACACTGAGGAGGAGG + Intergenic
905076016 1:35270691-35270713 CGGTGGTAGCAGGGAGGCGGTGG + Intronic
908999923 1:70205849-70205871 CGGTGGAAGCACAGAGGAGAAGG - Intronic
912393892 1:109324704-109324726 CAGTGCTAGCACCGAGGAGGAGG + Intronic
923126952 1:231040850-231040872 TGGGGGTGGCACAGAGGAGGTGG - Intergenic
1063564518 10:7161255-7161277 CAGTGGTAGCACGGAGGAGGAGG - Exonic
1063584083 10:7335122-7335144 CGGTGGTTGCCCAGAGAAGGGGG + Intronic
1065893621 10:30141983-30142005 CGGTGTTAGCACCTGGGAGGTGG + Intergenic
1066464872 10:35642238-35642260 CGCTGCTCCCGCCGAGGAGGAGG - Exonic
1068696257 10:59970984-59971006 GGGTTGTAGCACAGAGGAGGTGG - Intergenic
1074359420 10:112813162-112813184 CTGTGGGTGCACCAAGGAGGGGG + Intronic
1076149321 10:128149980-128150002 CGGGGGGCGCTGCGAGGAGGCGG - Intergenic
1076371931 10:129960761-129960783 CTGTTGTTGCACAGAGGAGGAGG - Intronic
1077600456 11:3571195-3571217 AGGTGGTTGCAGTGAGGAGGAGG - Intergenic
1081483294 11:43508194-43508216 CGGTGGGGGCACAAAGGAGGGGG + Intergenic
1083023682 11:59532063-59532085 CGTCTGTCCCACCGAGGAGGTGG - Intergenic
1083611674 11:64007368-64007390 AGGTGGCCCCTCCGAGGAGGTGG + Intronic
1083656222 11:64230911-64230933 CGGCGGCCGCTCCGAGGAGCCGG - Exonic
1084256368 11:67945817-67945839 AGGAGGTTGCACTGAGGAGGAGG - Intergenic
1089611610 11:119672501-119672523 CGATGGGGGCACCGAGGAGATGG - Intronic
1091184811 11:133637664-133637686 CGTTGGAGGCACAGAGGAGGTGG - Intergenic
1091866156 12:3839060-3839082 GCGTGTTCGCTCCGAGGAGGCGG + Intronic
1102453351 12:113057082-113057104 CGGGGGTCGCGTCGCGGAGGGGG - Intronic
1104837192 12:131799303-131799325 CGGTGCTAGCACCGTGGGGGCGG - Intronic
1113030600 13:105990013-105990035 CGGTGGTGGTGCCGAGGAGCTGG - Intergenic
1113665175 13:112136372-112136394 AGGTGGTCACACCTGGGAGGAGG - Intergenic
1113798660 13:113075125-113075147 CGGAGATCGCAAGGAGGAGGGGG + Exonic
1123040925 14:105489989-105490011 CAGTAGGCGCTCCGAGGAGGAGG + Intronic
1202903153 14_GL000194v1_random:54615-54637 AGAGGGTCGCAGCGAGGAGGTGG + Intergenic
1124188869 15:27554101-27554123 CTGTGAGCACACCGAGGAGGTGG + Intergenic
1127473945 15:59314682-59314704 TGGTGGTCAGACTGAGGAGGGGG + Intronic
1128119230 15:65133524-65133546 CGGTGGTGGCACCGGGTAGAAGG + Exonic
1128720117 15:69941842-69941864 CTGGGGTAGCACAGAGGAGGAGG - Intergenic
1130272632 15:82460017-82460039 AGGGGGTCTCGCCGAGGAGGAGG - Intergenic
1130464984 15:84187370-84187392 AGGGGGTCTCGCCGAGGAGGAGG - Intergenic
1130487704 15:84407434-84407456 AGGGGGTCTCGCCGAGGAGGAGG + Intergenic
1130499281 15:84486167-84486189 AGGGGGTCTCGCCGAGGAGGAGG + Intergenic
1130587274 15:85191984-85192006 AGGGGGTCTCGCCGAGGAGGAGG - Intergenic
1135745770 16:25015167-25015189 CGGGGGTCGCACCGGGGCTGGGG - Intronic
1138522512 16:57578851-57578873 GTGTGGCAGCACCGAGGAGGAGG - Intronic
1139510086 16:67422677-67422699 CGGTGGCCACAGTGAGGAGGAGG - Intergenic
1142192186 16:88723128-88723150 AGGTGGTCCCAGCCAGGAGGTGG - Exonic
1142221427 16:88856848-88856870 CGGTTGTCGCGGCGACGAGGTGG - Exonic
1143058004 17:4176856-4176878 GGGTGGGAGCACCGAGGAAGTGG - Intronic
1144884919 17:18451338-18451360 CGGTGGGAGCAGGGAGGAGGGGG - Intergenic
1145147304 17:20493039-20493061 CGGTGGGAGCAGGGAGGAGGGGG + Intergenic
1147636226 17:41966168-41966190 CAGTGGTTTCACAGAGGAGGTGG + Intergenic
1147970805 17:44218620-44218642 GGGCGGGCGCTCCGAGGAGGAGG - Intronic
1148021649 17:44557587-44557609 CGGCAGCCGCAGCGAGGAGGCGG + Exonic
1148785699 17:50145194-50145216 CGATCGTCGCAACGAGGATGTGG - Exonic
1151743127 17:75997353-75997375 CTGTGGTGGCGCCGGGGAGGGGG - Intronic
1159619601 18:70621963-70621985 CAGTGCTGGCACCGTGGAGGAGG + Intergenic
1160365547 18:78322883-78322905 AGGTGGTTGCACATAGGAGGTGG - Intergenic
1161003040 19:1920761-1920783 CTGGGGACGCACCGGGGAGGCGG - Intronic
1163554483 19:17984400-17984422 CTGGGGTAGCACCGAGGAAGTGG - Intronic
1163625496 19:18387022-18387044 CTGTGGTGGGACCCAGGAGGGGG + Intronic
1164642883 19:29839395-29839417 CTGGGGTGGCACGGAGGAGGAGG - Intergenic
1168721082 19:58555387-58555409 GGGTGGGCCCACCGAGGAGGAGG - Intergenic
928143698 2:28752305-28752327 CGGCGGACGAACCGAGGAGGGGG + Intronic
931953985 2:67397531-67397553 CGGTGGTCGAGCCAGGGAGGAGG + Exonic
934768494 2:96893877-96893899 TGGTGGTGGCACCGTGGTGGAGG + Intronic
938982105 2:136536723-136536745 CTGTGGCCTCACCAAGGAGGAGG + Intergenic
946391310 2:219418420-219418442 TGGCGGGCGCACGGAGGAGGCGG - Exonic
949023692 2:241755201-241755223 CGGTGGGCGGGCCGTGGAGGAGG - Intronic
1169278321 20:4248201-4248223 CTGCGGTATCACCGAGGAGGCGG - Exonic
1170887925 20:20356579-20356601 AGGTGGTCACACTGGGGAGGTGG + Intronic
1170887952 20:20356695-20356717 AGGTGGTCACACTGGGGAGGTGG + Intronic
1170887984 20:20356830-20356852 AGGTGGTCACACTGGGGAGGTGG + Intronic
1170888016 20:20356965-20356987 AGGTGGTCACACTGGGGAGGTGG + Intronic
1172122873 20:32608948-32608970 CGGTGGTCTCTCTGAGTAGGTGG + Intergenic
1173506566 20:43591573-43591595 CGGTGGTGGGACCATGGAGGGGG + Intronic
1174595304 20:51678902-51678924 TGGTGGTCTCACTGAGGATGAGG - Intronic
1175923185 20:62459387-62459409 CTGTGGGCCCTCCGAGGAGGAGG + Intergenic
1176622517 21:9069382-9069404 AGAGGGTCGCAGCGAGGAGGTGG + Intergenic
1182604144 22:31490032-31490054 AGGTGGTGGCGGCGAGGAGGAGG + Intronic
1182705014 22:32271541-32271563 AGGTGGCCGCACAGAGGAGAGGG + Intergenic
955413423 3:58670652-58670674 CCGTGGTGGCAGGGAGGAGGTGG + Intergenic
955916830 3:63915000-63915022 TGGAGGTTGCACTGAGGAGGTGG - Intronic
968544105 4:1187714-1187736 CAGTGATAGCACAGAGGAGGAGG - Intronic
968649581 4:1755182-1755204 AGCTGGTGGCACAGAGGAGGCGG - Intergenic
972566809 4:40276829-40276851 CAGTGTTAGCACCCAGGAGGAGG + Intergenic
981475120 4:145180186-145180208 GCGTGTTCGCTCCGAGGAGGCGG - Intergenic
999322617 5:150624750-150624772 CGGTGGCGGCGGCGAGGAGGGGG + Intronic
999369544 5:151045636-151045658 CAGTGGTCACTCTGAGGAGGTGG - Intronic
1002491081 5:179577756-179577778 CGGTGGTCGGGCGGCGGAGGCGG + Intronic
1003567671 6:7234351-7234373 AGGTGGGAGCACCGAGGAAGGGG - Intronic
1006834464 6:36988815-36988837 GGGTGGTGGCACCGAAGTGGGGG - Intergenic
1011642993 6:89432981-89433003 CGGTGGCCCCACCCAGGAGAGGG + Intergenic
1024117418 7:46207251-46207273 AGGTAGTCTCACTGAGGAGGTGG - Intergenic
1029724911 7:102396425-102396447 CGGTGGTCGCACCGAGGAGGCGG - Exonic
1033446367 7:141425829-141425851 CGGAGGTAGGACTGAGGAGGAGG + Intronic
1034453988 7:151154926-151154948 CGCTAGAGGCACCGAGGAGGAGG + Intronic
1036256609 8:7211645-7211667 AGGAGGTTGCACTGAGGAGGAGG - Intergenic
1036256612 8:7211662-7211684 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036256615 8:7211679-7211701 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036256618 8:7211696-7211718 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036256621 8:7211713-7211735 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036256624 8:7211730-7211752 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036256647 8:7211866-7211888 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036308659 8:7670230-7670252 AGGAGGTTGCACTGAGGAGGAGG - Intergenic
1036308662 8:7670247-7670269 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036308665 8:7670264-7670286 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036308668 8:7670281-7670303 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1036360870 8:8075796-8075818 AGGAGGTCGCAGTGAGGAGGAGG + Intergenic
1036360873 8:8075813-8075835 AGGAGGTCGCAGTGAGGAGGAGG + Intergenic
1036360876 8:8075830-8075852 AGGAGGTCGCAGTGAGGAGGAGG + Intergenic
1036360879 8:8075847-8075869 AGGAGGTTGCACTGAGGAGGAGG + Intergenic
1036890092 8:12591145-12591167 AGGAGGTTGCACTGAGGAGGAGG - Intergenic
1036890112 8:12591278-12591300 AGGAGGTCGCAGTGAGGAGGAGG - Intergenic
1047314482 8:123719972-123719994 AGGTGGTGGCACGTAGGAGGTGG + Intronic
1055315243 9:75028157-75028179 AGGCGGTGGCAGCGAGGAGGTGG - Exonic
1057797288 9:98167835-98167857 CGGTTGTTGGACAGAGGAGGAGG + Intronic
1061941056 9:133884066-133884088 CGGAGGTTGCAGCGAGGCGGAGG + Intronic
1062341411 9:136095305-136095327 CGGCGGCCGCACCGCGGCGGGGG + Intergenic
1187332804 X:18355401-18355423 TGGAGGTCGCACAAAGGAGGGGG + Intergenic
1189134533 X:38534569-38534591 CGGTGGGTGCTCCAAGGAGGAGG - Intronic
1198215245 X:134549517-134549539 CCGGGGTCGCAGCGTGGAGGGGG + Intergenic
1198772394 X:140144750-140144772 AGGTGGAAGCACAGAGGAGGTGG + Intergenic
1201159036 Y:11154823-11154845 AGAAGGTCGCAGCGAGGAGGTGG + Intergenic