ID: 1029724912

View in Genome Browser
Species Human (GRCh38)
Location 7:102396428-102396450
Sequence CCTCGGTGGTCGCACCGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724912_1029724921 23 Left 1029724912 7:102396428-102396450 CCTCCTCGGTGCGACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724912_1029724922 26 Left 1029724912 7:102396428-102396450 CCTCCTCGGTGCGACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724912_1029724920 20 Left 1029724912 7:102396428-102396450 CCTCCTCGGTGCGACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1029724920 7:102396471-102396493 GCTCGTCATCCCCAAGAATGCGG 0: 1
1: 0
2: 0
3: 10
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724912 Original CRISPR CCTCGGTGGTCGCACCGAGG AGG (reversed) Exonic
900323573 1:2096524-2096546 CCTCGGTGGGCGCTCAGAGGCGG + Intronic
901068626 1:6506423-6506445 CCTCGGTGGGGGCTCCGAGGGGG - Intronic
901115025 1:6836647-6836669 CGTCTGCGGTAGCACCGAGGTGG + Intronic
904322799 1:29707830-29707852 CCTCTGTGGTCTGACCCAGGTGG + Intergenic
904376558 1:30085698-30085720 CCTCTGTGGTCTGACCCAGGTGG - Intergenic
913289122 1:117256344-117256366 CCTCAGTGGTGGCACCCATGTGG + Intergenic
913531485 1:119737167-119737189 CCTTGGTGCTGGCACCCAGGTGG - Exonic
919739067 1:200971775-200971797 CCTCTGTGGCAGCTCCGAGGAGG + Intronic
1067116203 10:43437198-43437220 CCTCGGCGGTCTCTCGGAGGAGG - Exonic
1074899968 10:117807593-117807615 CCTGGGTGGTCACACAGATGTGG + Intergenic
1091552521 12:1547362-1547384 CCTTGGCGGTCACACCGATGTGG + Intronic
1102453354 12:113057085-113057107 CCTCGGGGGTCGCGTCGCGGAGG - Intronic
1116018446 14:39432962-39432984 CCTGCGTGGTTGGACCGAGGGGG - Intergenic
1142223293 16:88865604-88865626 CCTCGGGGGTCCCAGAGAGGGGG + Exonic
1151497235 17:74466260-74466282 CCTCGGTGGTGCCCACGAGGAGG - Intergenic
1152081044 17:78187275-78187297 ACTTGGTGGGCGGACCGAGGCGG - Intergenic
1161613538 19:5257349-5257371 GCTCGGTAGTTGCACCGAGCTGG - Intronic
1165861325 19:38911042-38911064 CCTCGGTGGACGCACAGCCGTGG + Exonic
938074338 2:128323694-128323716 CCTGGGTGGGGGCACAGAGGTGG + Intergenic
942629927 2:177944701-177944723 CCTCGGCGGTCTCTCGGAGGAGG - Intronic
1171217886 20:23365397-23365419 CCTCGGTGGCCACGCCGTGGCGG - Exonic
1181567972 22:23751202-23751224 TCTCGGTGGTCCCACCGCGCCGG + Intergenic
966486424 3:180476195-180476217 CCTTGGTGGTCGTGCTGAGGTGG - Intergenic
970407588 4:15778530-15778552 TCGCGGTGGTCGTCCCGAGGTGG + Exonic
985844820 5:2336335-2336357 CCTGGGTGGTGGCACCCAGAGGG + Intergenic
987006828 5:13718981-13719003 CCTCGGTGGTCATCCAGAGGCGG + Exonic
998176436 5:139904629-139904651 CCTCGGTGGGCCCAGGGAGGGGG - Intronic
1002175854 5:177400695-177400717 CCTGGGTGGTCGCTCCGGGACGG - Intergenic
1003108002 6:3229814-3229836 CCTGGGAGCTCGCAGCGAGGGGG - Intronic
1027370895 7:77508446-77508468 CCTCGGCGGTCTCTCGGAGGAGG - Intergenic
1029724912 7:102396428-102396450 CCTCGGTGGTCGCACCGAGGAGG - Exonic
1034635438 7:152563733-152563755 CCTCAGTGGACTCACAGAGGTGG - Intergenic
1034994587 7:155570023-155570045 AATCGGTGGTCCCAGCGAGGAGG - Intergenic
1051374677 9:16391077-16391099 CCTCGGTGTTAGCACAGAGTTGG - Intergenic