ID: 1029724914

View in Genome Browser
Species Human (GRCh38)
Location 7:102396431-102396453
Sequence GGGCCTCGGTGGTCGCACCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724914_1029724920 17 Left 1029724914 7:102396431-102396453 CCTCGGTGCGACCACCGAGGCCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1029724920 7:102396471-102396493 GCTCGTCATCCCCAAGAATGCGG 0: 1
1: 0
2: 0
3: 10
4: 62
1029724914_1029724921 20 Left 1029724914 7:102396431-102396453 CCTCGGTGCGACCACCGAGGCCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724914_1029724922 23 Left 1029724914 7:102396431-102396453 CCTCGGTGCGACCACCGAGGCCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724914 Original CRISPR GGGCCTCGGTGGTCGCACCG AGG (reversed) Exonic
900284573 1:1892928-1892950 GGGCCTCGGTGGTCCAGCGGAGG - Intergenic
901115024 1:6836644-6836666 GGGCGTCTGCGGTAGCACCGAGG + Intronic
901808125 1:11750456-11750478 GGGCCTCTGTGGTGCCACCATGG - Exonic
902214348 1:14924774-14924796 GGGGCTCGGGGGCTGCACCGGGG + Intronic
912684132 1:111748798-111748820 GAGCCTCGGTGGTGACACTGAGG - Intronic
915634113 1:157174418-157174440 AAGCCTCGGTGGTCTCACTGGGG - Intergenic
922440832 1:225653551-225653573 GCGCCTCGGTCTCCGCACCGTGG - Intergenic
922734503 1:227971993-227972015 GGGCCTGGGAGGTCGCAGTGGGG + Intergenic
1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG + Intergenic
1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG + Intronic
1076096328 10:127737171-127737193 GGGCCGGGCTGGTCGCACCCGGG + Intergenic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG + Intronic
1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG + Intronic
1085619022 11:78023292-78023314 GAGCCTCGGTGTTCCCACCTAGG - Exonic
1088305074 11:108399123-108399145 GCACCTCAGTGGTTGCACCGTGG - Intronic
1090941574 11:131392425-131392447 GGGGCTCTGTGGTTGCACAGAGG - Intronic
1103852131 12:123940164-123940186 GGGCCCTGGTGGTCGGACTGGGG + Intronic
1104685313 12:130780988-130781010 GGGGATCGGTGGACGCTCCGTGG - Intergenic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG + Intronic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132975777 16:2710434-2710456 GGGCCTTGGTGGCTGCACTGTGG - Intergenic
1144763944 17:17722925-17722947 TGGCGTCGGGGATCGCACCGCGG - Intronic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151881230 17:76896014-76896036 GGGCCTTGGTGTTGTCACCGTGG - Intronic
1152072900 17:78142885-78142907 GGGCCTCGGTGTGCTCACCCAGG + Exonic
1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG + Intergenic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1152637301 17:81435390-81435412 GGGCAGTGGGGGTCGCACCGAGG - Intronic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1163117150 19:15195686-15195708 GGGCCGCAGTGGTCGCCCTGCGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
925327953 2:3037342-3037364 GGGACCCCGTGGACGCACCGGGG - Intergenic
925444909 2:3919319-3919341 GGGCCTGGGTGATGGCACGGTGG + Intergenic
928303547 2:30147402-30147424 GGGCCTCGGAGGACGCGACGGGG - Intronic
934538943 2:95159169-95159191 GCGCCGCGCTGGGCGCACCGGGG - Intronic
1174170883 20:48617633-48617655 GGGCATCGGTGGTGACACTGAGG + Intergenic
1176103969 20:63377063-63377085 CGGCCCCGGTGGTCGCCCGGGGG - Intronic
1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG + Intergenic
1182115944 22:27756441-27756463 GGGGCTCAGTGGTGGAACCGTGG - Intronic
1183524795 22:38316876-38316898 GGGCCTCGGAGGGCCCAGCGGGG + Intronic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
1184690250 22:46114196-46114218 GGGCCTTGGTGGCTGCCCCGTGG - Intergenic
1184801490 22:46762995-46763017 GGGGCTCGGAGGTCGGAGCGTGG + Intronic
950423990 3:12914816-12914838 GGGCCTCAGAGGACACACCGGGG + Intronic
953198225 3:40753939-40753961 GGGCCTCGGTGCTCACACTTGGG - Intergenic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
959056947 3:101576509-101576531 TGGCCGCCGTGGCCGCACCGTGG - Intronic
961451611 3:127004747-127004769 GGGCCATGGTGGTCTCACAGTGG + Intronic
962575374 3:136751641-136751663 GGGCCTGGGGGGTCGCTCGGCGG - Intronic
968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG + Intergenic
985866108 5:2515785-2515807 AGGCCTCGGTGGGCGCTCTGCGG + Intergenic
990954878 5:61331786-61331808 GCGCCTCGTGGGTCGCAGCGGGG - Intergenic
1006313280 6:33276424-33276446 TGGCCGCCGTGGCCGCACCGTGG + Exonic
1020073130 7:5240459-5240481 GGGGCTGGGCGGTCGCACCCGGG + Intergenic
1024043764 7:45574279-45574301 GGGGCTCGGCTGTCGCAGCGCGG + Intronic
1026525048 7:71146221-71146243 GGGCTGCGGTGGTGGCACCCGGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1049108086 8:140625994-140626016 GGGCCTTGCTGGGCGCACCTTGG - Intronic
1049752425 8:144291540-144291562 GGGCCTGCGTGCTCGCGCCGGGG + Intergenic
1060770078 9:126326535-126326557 AGGCCCGGGTGGGCGCACCGGGG + Intergenic
1062255249 9:135617757-135617779 GGGCCTGGGAGGTCGCAGAGGGG + Intergenic
1062459981 9:136658985-136659007 GAGCCTCGGGGGTCGCCCGGGGG - Exonic
1192153176 X:68724437-68724459 GGGCCTGGGTGGTGCCACCCTGG - Exonic
1200316382 X:155137125-155137147 GCTCATCGGTGGTCGCCCCGAGG - Intronic
1202115260 Y:21465656-21465678 GGGCCTCGGTGGTGTCTCAGTGG - Intergenic