ID: 1029724915

View in Genome Browser
Species Human (GRCh38)
Location 7:102396442-102396464
Sequence GGCTCTTTCTTGGGCCTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724915_1029724921 9 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724915_1029724926 30 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724926 7:102396495-102396517 GGAGGAGCAGAAGCTCAAGCTGG 0: 1
1: 0
2: 5
3: 95
4: 490
1029724915_1029724922 12 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724915_1029724920 6 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724920 7:102396471-102396493 GCTCGTCATCCCCAAGAATGCGG 0: 1
1: 0
2: 0
3: 10
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724915 Original CRISPR GGCTCTTTCTTGGGCCTCGG TGG (reversed) Exonic
900496867 1:2979688-2979710 GGCTGTGTGTTGGGCCTCTGAGG + Intergenic
900507412 1:3036600-3036622 GGCTCCTTCCTCGACCTCGGGGG + Intergenic
900507420 1:3036624-3036646 GGCTCCTTCCTCGACCTCGGAGG + Intergenic
901221499 1:7586372-7586394 GGCTTTATCTCGGGCCTCTGGGG - Intronic
901557200 1:10041025-10041047 GACTCTTTCTTAAGCCTGGGAGG + Intronic
903923333 1:26816777-26816799 GGCTCTTGCTTGAACCTGGGAGG + Intergenic
905645207 1:39620448-39620470 GGGTATTCCTTGGGCCTGGGAGG + Intergenic
906034039 1:42740014-42740036 GGCTACTTCTTGGCCCTGGGTGG - Exonic
908293188 1:62688178-62688200 GGCTCTTTCTCGGGCGGCGGCGG + Intronic
911980375 1:104559097-104559119 GGCTCTTTCTTGGATGTAGGAGG - Intergenic
914899608 1:151704786-151704808 GGCTCTTTCTGGGGTCACGGAGG + Intronic
915587941 1:156854441-156854463 GCCTCCTTCCTGGGCCCCGGAGG + Intronic
916119403 1:161514060-161514082 GGCTATTTCTAAGGCCTGGGTGG - Intronic
917512527 1:175680192-175680214 TGTTCTTTCTTGTGCCTCTGTGG + Intronic
919112741 1:193241364-193241386 GGCTATTCCTTGGGCCCCAGTGG + Intronic
921054155 1:211531553-211531575 GGCTCTGTGTTGGGCATGGGGGG + Intergenic
1065807647 10:29409741-29409763 CGCTGTCTCTTGGGCCGCGGTGG + Intergenic
1069994830 10:72335771-72335793 GGCTCATACTTGGACCTCGGTGG + Exonic
1072878653 10:99203015-99203037 GGCTCGTTCTGGGGCCATGGGGG - Intronic
1075245940 10:120822248-120822270 GGGTCTTTTCTGGGCCTAGGAGG - Intergenic
1076323777 10:129604647-129604669 GGCTCTGTCTTGGGAGTTGGGGG + Intronic
1076981397 11:206905-206927 GACTCTTACTTTGGCCTCGGTGG - Intronic
1077546115 11:3170756-3170778 GGCTCCTGCTTGGGGCTCGGGGG + Intergenic
1078613518 11:12843163-12843185 GGCCCTTTCTTGGTCTTGGGAGG + Intronic
1080317850 11:30970547-30970569 GGCTCATGCTTTGGCCTTGGTGG - Intronic
1081065456 11:38534856-38534878 GGCTTGTTATTGGGCTTCGGTGG - Intergenic
1081162878 11:39772482-39772504 GGATCTTTCCTGAGCCTTGGGGG - Intergenic
1082210474 11:49495560-49495582 GGCTCTTTCTGAGGCCTGTGAGG + Intergenic
1083618372 11:64037087-64037109 AGCTCTGGCTTGGGCCTCGGGGG - Intronic
1083989764 11:66239700-66239722 TGCTCTTTCTTGCACCTGGGAGG - Intronic
1084704018 11:70805338-70805360 GGCTCCCACTTGGGCCTAGGGGG + Intronic
1085203850 11:74718402-74718424 GGCTCTGTCTTGGGCTGCGTGGG + Intronic
1086227885 11:84534419-84534441 GGGTCTTTCTTGTGCATTGGAGG - Intronic
1086639153 11:89129240-89129262 GGCTCTTTCTGAGGCCTGTGAGG - Intergenic
1095905081 12:47369229-47369251 TGCTCTTTCCTAGGCCTCAGTGG - Intergenic
1096789436 12:54035736-54035758 AGATCTTTCCTGGGCCTAGGTGG + Intronic
1102977747 12:117218728-117218750 GGCTGTTTCTTGAGACTCCGGGG - Intronic
1103050894 12:117778665-117778687 GGCTCTCTCATGGGCCTCTGAGG + Intronic
1104897530 12:132171631-132171653 GGCGCTTTCTTGGCCCTGTGGGG + Intergenic
1106308929 13:28535651-28535673 GGGGCTTTCATGGGCCTCAGAGG - Intergenic
1108569100 13:51731673-51731695 GGCTCGTTCTGGGCCCTGGGAGG + Intronic
1111496839 13:89061997-89062019 GGCTCCCTCTTAGGCCCCGGTGG + Intergenic
1111512672 13:89287315-89287337 GGCCCTTTTATGGGCCTCAGAGG + Intergenic
1113304053 13:109057577-109057599 GTCTCTTTCTGGTCCCTCGGTGG + Intronic
1113553502 13:111212330-111212352 GGCTCTGTGATGGGCCTCGGTGG + Intronic
1113732195 13:112649460-112649482 GGCTCTGTCTAGTGCCTAGGCGG - Intronic
1116068043 14:40008825-40008847 GGCTCTTTCTTGGTTATAGGAGG - Intergenic
1118639876 14:67782459-67782481 AGCTCTATCCTGGGCCTCTGGGG + Intronic
1119740940 14:77013396-77013418 GGCTCTTTCTTTGCCCACTGTGG - Intergenic
1121866394 14:97366525-97366547 GTCGCTTTCTTGTGCCTCTGAGG + Intergenic
1123948435 15:25250121-25250143 GGCCCTTCCTTGGGCCAAGGGGG + Intergenic
1126695445 15:51321800-51321822 TACTCTTTCATGGGCCTCTGGGG - Intronic
1127614332 15:60668551-60668573 AGCTATTTCATTGGCCTCGGGGG + Intronic
1127770899 15:62230003-62230025 GGGTGTTTCTTGGGACTTGGAGG + Intergenic
1127889313 15:63234749-63234771 GGCTCTTTCCTGCACCTCTGAGG - Intronic
1128016893 15:64355888-64355910 GGCCCTTTCCTGGGCGTGGGTGG - Intronic
1128322572 15:66703523-66703545 GGCTCCGACATGGGCCTCGGGGG - Exonic
1128546967 15:68574886-68574908 TGCTCTTTCCTGGGCCTCTGGGG - Intergenic
1129559492 15:76551915-76551937 TCCTCTTTCTTTGGCCTGGGAGG + Intronic
1129761297 15:78130783-78130805 GGCTCCTTCCTGGGGCTGGGGGG + Intronic
1129958442 15:79660964-79660986 GGCACTGTGTTGGGCCTTGGAGG + Intergenic
1130394909 15:83493478-83493500 GGCTCTGTCTTGGGGATCAGTGG + Intronic
1132665970 16:1081526-1081548 GGCCCTGTGTCGGGCCTCGGGGG - Intergenic
1133277119 16:4645754-4645776 GGCCTTGTCTGGGGCCTCGGAGG + Intronic
1134251633 16:12578235-12578257 GGCTCCTCCTGGGGCCTCTGAGG - Intergenic
1136172661 16:28498002-28498024 GGCTCTTGGTGGGGTCTCGGGGG + Intronic
1138425485 16:56929355-56929377 GGTTCCTTCTGAGGCCTCGGGGG - Intergenic
1138934078 16:61697377-61697399 GGGTCTATGTTTGGCCTCGGTGG - Intronic
1139504265 16:67391283-67391305 GGCTCTTCCTTGGGGCTCTGTGG - Exonic
1147850635 17:43439962-43439984 GGCTCTTTCCTGGTCCTTGATGG + Intergenic
1148455071 17:47806951-47806973 GGCTCCTTCTTGAGGCTCAGTGG + Intergenic
1148581469 17:48747034-48747056 GGCTCCTTCTGGGGACTCCGGGG + Intergenic
1152652185 17:81499801-81499823 GGGCCTCTGTTGGGCCTCGGAGG + Intergenic
1156606320 18:38671412-38671434 GCCTCTTTCTTGGTCGTAGGAGG - Intergenic
1159893296 18:73973126-73973148 GTCTCTGTCTTTGGCCTCAGGGG + Intergenic
1160174062 18:76579032-76579054 GGCGCTTCCCTGGGCCTCGGGGG - Intergenic
1161397556 19:4052573-4052595 GCCTCTTTCTTCAGCCTCGGTGG + Intronic
1162344502 19:10111477-10111499 GGCTCTTTGGTGGGACTGGGGGG - Intronic
1162780765 19:13006024-13006046 GGCTCTGTTTTAGGCCCCGGGGG + Intronic
1163319846 19:16568227-16568249 GGCTCTTCCCTGGGCATCTGTGG - Intronic
1163723575 19:18910074-18910096 TGCTCTTCCTTGGCCCACGGAGG - Intronic
1166955784 19:46464016-46464038 AGCTTTTTCTTGGGCCTCCTGGG + Intergenic
1168076949 19:53985744-53985766 GGATCTCGCTTGGGCCTGGGAGG + Exonic
1168121712 19:54255525-54255547 GGCTCTGTCGTGGCCCGCGGAGG - Exonic
1168209974 19:54883345-54883367 GGTCCATTCTTGGGCCTTGGAGG + Intronic
926135521 2:10332994-10333016 GGGTCTTTGTTGGGGCTCTGTGG + Intronic
926708123 2:15851054-15851076 TGTTCCTTCTTGGGCCTCTGAGG - Intergenic
927877930 2:26671013-26671035 GGCTCATCCATGGGCCTCTGTGG - Intergenic
928378658 2:30799712-30799734 GCCTCTTCCCTGGCCCTCGGTGG - Intronic
932570291 2:72934896-72934918 TGCTCTTTCTTGGGCTGAGGAGG - Intronic
932862103 2:75305003-75305025 TGCTCTTGCTTGGGCCTGGGTGG + Intergenic
932978101 2:76629256-76629278 GGCTGATTCTTGGGCCTCCAGGG + Intergenic
935564365 2:104590607-104590629 GCCTCTTTCTTGGTCGTAGGAGG + Intergenic
936283849 2:111165661-111165683 GACTCTTTCTTGGGTCTCCCTGG - Exonic
936343834 2:111660163-111660185 GGCTCCTTCCAGGGCCTGGGAGG - Intergenic
936389068 2:112055446-112055468 GGCTCGCGCTTGGGCCTGGGCGG - Exonic
936479681 2:112874499-112874521 TGCTCTTTTTTGGCCCTCAGGGG - Intergenic
947337086 2:229098570-229098592 TGCTCTTTCCTGGGGCTGGGGGG + Intronic
947535831 2:230940020-230940042 GGCTCTTTCTGGTGCCTGGCAGG - Intronic
948570671 2:238915321-238915343 GGTTCTTTCTGGAGGCTCGGAGG - Intergenic
1172865122 20:38089983-38090005 GGTTCTTTCTTGAGGCTGGGGGG - Exonic
1173952930 20:47007498-47007520 AAATCTTTCCTGGGCCTCGGAGG - Intronic
1174660714 20:52210568-52210590 GCCTCTCTCTTGGTCTTCGGCGG + Intergenic
1175996537 20:62814539-62814561 GGCTTTTTGTGGGGCCTCAGAGG + Intergenic
1176083069 20:63283619-63283641 GGCTTTTTCGTGGGCCTCCCAGG + Intronic
1179496582 21:41775648-41775670 AGCTCATTCTTGAGCCTCAGAGG + Intergenic
1180999947 22:19983349-19983371 TGCCCATTCTTGGGCCTGGGAGG + Intronic
1181438623 22:22924378-22924400 GGCTCCTTCTGGGGACTCTGGGG + Intergenic
1184604108 22:45562526-45562548 GGCTCTTGGTTGTGTCTCGGAGG - Intronic
1184949747 22:47832878-47832900 GGCTCTCTCTGGGGTCACGGTGG + Intergenic
1185194479 22:49460401-49460423 GGCTCCTTCTCAGGCCTTGGAGG + Intronic
1185351679 22:50342957-50342979 GGCCCTTTCCTGGGCCACGGGGG + Intergenic
949170092 3:986950-986972 GCCTCTTTCTTGGTCATGGGAGG + Intergenic
949478537 3:4471569-4471591 GGCACTTTCTTGGGGGTGGGAGG + Intergenic
950572655 3:13811610-13811632 GGTGCTCTCTTGGGCCTCAGAGG + Intergenic
950747289 3:15100503-15100525 GGCTCGTTTTGGGACCTCGGTGG - Intergenic
953069155 3:39502557-39502579 GGCTGTTGCTTGGGCCTCTGAGG - Exonic
954746447 3:52790125-52790147 GCCTCTTTGCTGGGCCTGGGAGG - Intronic
956139909 3:66135677-66135699 GGATCTCTCTTGAGCCTGGGAGG + Intronic
959989394 3:112614509-112614531 GGCTCTTTGTCTGGTCTCGGGGG - Intronic
962537610 3:136344389-136344411 GCCTATTTCCTGGGCCTCGTAGG + Intronic
963504245 3:146163974-146163996 GGCTCATGCTTGGGCTTCAGAGG - Intergenic
963603565 3:147396519-147396541 CGCTCTTCCCTGGGCCCCGGGGG + Intronic
966044381 3:175531274-175531296 GCCTCTTTCTTGGTCATAGGAGG + Intronic
966840170 3:184081664-184081686 GGGGCTTTCATGGGCCTCAGAGG - Intergenic
968230083 3:197000397-197000419 TCCTTTTTCTGGGGCCTCGGTGG + Intronic
969084612 4:4646545-4646567 GGCTCTAACTCGGGCCTGGGAGG + Intergenic
975221283 4:71814932-71814954 GGGTCTTTCCTGGGACTCCGAGG + Intergenic
979592829 4:122500111-122500133 GGTTCTTTCTGGGGGCTCTGAGG + Intergenic
982076030 4:151738008-151738030 GACTCTGTCTTGGGGCTCTGGGG - Intronic
985298272 4:188458463-188458485 TGTTCTTTCTTTGGCTTCGGTGG - Intergenic
985914962 5:2910631-2910653 GGCACCTTCTTGGGACTCAGTGG - Intergenic
986232292 5:5877351-5877373 AGCTCATTCTTTGGCCTCTGAGG - Intergenic
990011752 5:51007310-51007332 TGTTCTTTCTTGGGCTTCAGTGG + Intergenic
991410292 5:66339012-66339034 GCCTCTTTCTTGGGGCCCAGTGG + Intergenic
993791737 5:92218563-92218585 GGCTCTTTCTTGGTTGTAGGAGG - Intergenic
994401227 5:99282143-99282165 GGCTGTTTCTTGGTCCTCATTGG + Intergenic
996548622 5:124707249-124707271 GTCTCTTTGTTGGGTCTGGGTGG - Intronic
998792287 5:145778127-145778149 GGGTCTTTTATGGGCCTCAGAGG - Intronic
1000067087 5:157703655-157703677 GGCTCTTTCTGGAGGCTCTGAGG - Intergenic
1000197374 5:158972739-158972761 GGCCATTTCTTGGGCCCCGTGGG - Intronic
1000622879 5:163505496-163505518 CCCTCTTTCTGGGGCGTCGGCGG + Intronic
1000837723 5:166177082-166177104 GCCCCTTCCTTGGGCCCCGGTGG - Intergenic
1003061099 6:2863372-2863394 GGTTCCTTCTTGGGACTCAGAGG + Intergenic
1003164195 6:3661762-3661784 GGCACGTTCTTGGTCCTCAGAGG - Intergenic
1003203942 6:3990336-3990358 GGCTCTTTCTGGGGGCTGTGAGG + Intergenic
1003978936 6:11371052-11371074 GGCACTTTCTTGGCCTTCTGGGG + Intronic
1006077216 6:31541564-31541586 AGCTCTTTCTCGGCCCTCGGTGG - Intronic
1006694717 6:35921113-35921135 GGCTCGGTTTTGGGCCGCGGCGG - Exonic
1007349223 6:41256429-41256451 GGCTGATTCTTGGGCATCTGGGG - Intergenic
1007800071 6:44384718-44384740 GGCTCCTTCTTGGGGCTCAGAGG + Intergenic
1007850207 6:44795433-44795455 GGCCCTTTCTTGAGGCTCCGGGG + Intergenic
1019661771 7:2228184-2228206 GAGTCTGTCTTGGGGCTCGGAGG - Intronic
1019985293 7:4650978-4651000 GACTCCTTTTTGGGCCTCTGAGG - Intergenic
1020109067 7:5437995-5438017 GGGTCTCTCATGGGCCTCAGTGG + Intronic
1020605293 7:10329761-10329783 AGCTTTTTCTGGGGCCTGGGTGG - Intergenic
1021645292 7:22783667-22783689 CACTCTTTCTTGGGTCTGGGAGG - Intergenic
1024744148 7:52388086-52388108 GGCTCTTTCTTGGTTGTAGGAGG - Intergenic
1026903027 7:74047476-74047498 GGGTGTTCCATGGGCCTCGGGGG + Intronic
1029193575 7:98788702-98788724 AGCTCTTTGGGGGGCCTCGGTGG + Intergenic
1029536377 7:101160163-101160185 GGATCTTTCTGGGGCCCTGGGGG - Intronic
1029724915 7:102396442-102396464 GGCTCTTTCTTGGGCCTCGGTGG - Exonic
1030457516 7:109793404-109793426 GCCTCTTTCTTGGGTGTAGGAGG + Intergenic
1036828504 8:11999944-11999966 GGCTCTTTCTTCTGCCTCCTGGG + Intergenic
1037517377 8:19646306-19646328 GGATCTTTCTTCAGCCTCTGGGG - Intronic
1037993746 8:23338596-23338618 GGTCCCTTCTTGGGCCTCAGAGG + Intronic
1038353983 8:26809372-26809394 TGCTTTCTTTTGGGCCTCGGTGG - Intronic
1041171192 8:55143724-55143746 GGGTCATTCTTGGGACTTGGAGG - Intronic
1041986130 8:63924120-63924142 GGCTCTTTCTTGGTTGTAGGAGG - Intergenic
1045564306 8:103298603-103298625 GGCTCAGCCTTGCGCCTCGGGGG + Intronic
1047739362 8:127794473-127794495 GGCTCGCGCTCGGGCCTCGGGGG - Intergenic
1048083896 8:131157195-131157217 GCCTCTTTCTTGGGTGTAGGAGG + Intergenic
1049414721 8:142489969-142489991 AGCCCTTCCTTGGGCCTCAGAGG + Intronic
1049491415 8:142905115-142905137 GGCTCTAACTTGGGCCTGTGCGG - Intronic
1050242949 9:3658039-3658061 GGCTGATTCTTGGGCCTCCAGGG + Intergenic
1053462710 9:38282887-38282909 GGCTCTTCCTTGTGACTTGGTGG + Intergenic
1055969609 9:81898760-81898782 GACTCTTTCCTGGGCCTGGAAGG - Intergenic
1057211134 9:93201702-93201724 GGCTCTTTCTCAGGACACGGGGG - Intronic
1059119196 9:111626998-111627020 GGATCCTTCTGGGGCCTCTGAGG + Intergenic
1062550378 9:137083333-137083355 GGCTCTTTCTGTGGCCTTGCTGG - Exonic
1186384151 X:9092114-9092136 GCCTCTTTCTTGGGTATAGGAGG + Intronic
1186432546 X:9517364-9517386 TGCTCCTGCCTGGGCCTCGGAGG - Intronic
1186863831 X:13699694-13699716 GGCTGTTACTTTGGCCTGGGAGG - Intronic
1190233557 X:48599902-48599924 GGCTCTCTCTTAGGCTTCTGAGG - Intronic
1197177478 X:123500878-123500900 GGCTCATTCCTGGCCCTCAGTGG - Intergenic
1197591817 X:128419038-128419060 GCCTCTTTCTTGGTCGTAGGAGG - Intergenic
1199024325 X:142919365-142919387 GCCTCTTTCTTGGTCGTAGGAGG - Intergenic
1200165218 X:154030967-154030989 GGCTTTCTTTTTGGCCTCGGCGG + Exonic