ID: 1029724916

View in Genome Browser
Species Human (GRCh38)
Location 7:102396445-102396467
Sequence TGCGGCTCTTTCTTGGGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724916_1029724920 3 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724920 7:102396471-102396493 GCTCGTCATCCCCAAGAATGCGG 0: 1
1: 0
2: 0
3: 10
4: 62
1029724916_1029724922 9 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724916_1029724921 6 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724916_1029724926 27 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724926 7:102396495-102396517 GGAGGAGCAGAAGCTCAAGCTGG 0: 1
1: 0
2: 5
3: 95
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724916 Original CRISPR TGCGGCTCTTTCTTGGGCCT CGG (reversed) Exonic
900160785 1:1222463-1222485 AGAGGCTCTTCCTTGGGTCTGGG - Intronic
901240394 1:7689696-7689718 AGCTGCTCTTCCTGGGGCCTGGG - Intronic
901503548 1:9669397-9669419 TGAGACTGTTTCTTGGGCCATGG - Intronic
902260738 1:15222967-15222989 TGCTGCTCTTTCATAGCCCTGGG - Intergenic
903923332 1:26816774-26816796 TGAGGCTCTTGCTTGAACCTGGG + Intergenic
907637454 1:56150446-56150468 TGGGGCTCTCTCTTTGGCATTGG - Intergenic
907638338 1:56159062-56159084 TCCAGCTCTATCTTGGACCTCGG - Intergenic
907880999 1:58549174-58549196 GGGGGCACTTTCTTGGGACTTGG - Intergenic
908293187 1:62688175-62688197 CGCGGCTCTTTCTCGGGCGGCGG + Intronic
909869631 1:80722958-80722980 TGGGGCTGTTTCTTAGGCCCTGG + Intergenic
910943300 1:92560430-92560452 TGGGTCTATTTCTTGGACCTAGG + Intronic
911980376 1:104559100-104559122 TGTGGCTCTTTCTTGGATGTAGG - Intergenic
912639616 1:111332714-111332736 TGGGACTGCTTCTTGGGCCTAGG + Intergenic
914878820 1:151532271-151532293 TCTTGCTCTTTCCTGGGCCTAGG - Intronic
914880162 1:151540663-151540685 TGCGGCTCCTGCCTGGGACTCGG + Intronic
915279831 1:154814851-154814873 CGCTGCTCTTCTTTGGGCCTCGG - Intronic
915523736 1:156463928-156463950 TGGGGCTCTTCCTGGGTCCTGGG - Exonic
916149958 1:161777581-161777603 TGAGGAGCCTTCTTGGGCCTTGG + Intronic
916597356 1:166257381-166257403 TGCTGCTGTGGCTTGGGCCTTGG + Intergenic
918279235 1:182987036-182987058 TCCTCCTCCTTCTTGGGCCTGGG + Intergenic
921196077 1:212759597-212759619 TGCTGCGGTGTCTTGGGCCTTGG - Intronic
922047994 1:221965378-221965400 TACGGCTCTTTCATGGGCCATGG + Intergenic
922580381 1:226692956-226692978 TTCAGCTTTTTCCTGGGCCTGGG + Intronic
923804018 1:237238482-237238504 TGGGGCTGTGTCATGGGCCTTGG + Intronic
924652905 1:245947024-245947046 TGCTGCTCTTCCGTGGCCCTGGG + Intronic
1067269430 10:44776621-44776643 TACTGCTCTTTCATGGGCTTTGG + Intergenic
1069761626 10:70815609-70815631 TGGGTCTCTTTCCTGGGCCAGGG - Intergenic
1070701227 10:78603049-78603071 TGCTGCTCTATCTAGGGTCTAGG + Intergenic
1072228121 10:93388564-93388586 TTGGTCTCTTTCTTGAGCCTTGG + Intronic
1072735159 10:97874176-97874198 TGCAGCTCCTTTTTGGGCCTTGG + Intronic
1073029750 10:100516219-100516241 TGCTGCCTTTTCTTGTGCCTAGG - Exonic
1073073874 10:100811216-100811238 TGCAGCTCTTTCTTGGGTAATGG - Intronic
1073830809 10:107380758-107380780 TGCTTCTGTTTCCTGGGCCTTGG - Intergenic
1076323774 10:129604644-129604666 TGTGGCTCTGTCTTGGGAGTTGG + Intronic
1076350501 10:129811752-129811774 TGCGACTCTTTCCAGGCCCTGGG - Intergenic
1076797923 10:132807790-132807812 TGGGGCTGTTTCTTCAGCCTGGG - Intergenic
1077077652 11:708712-708734 CTTGGCTCTTTCCTGGGCCTGGG - Intronic
1077387220 11:2275746-2275768 TGCCCCTCTTTGCTGGGCCTGGG - Intergenic
1078171595 11:8932803-8932825 TGCGGCTTGATCTTGGGCCCTGG - Intronic
1081162881 11:39772485-39772507 TGGGGATCTTTCCTGAGCCTTGG - Intergenic
1084558144 11:69887229-69887251 TGCAGCTCAATGTTGGGCCTCGG - Intergenic
1089192708 11:116665269-116665291 TGCCTCTCTTTCTTGGCACTAGG - Intergenic
1089389499 11:118090883-118090905 TTCTGCACTTTCTGGGGCCTTGG - Intronic
1089974857 11:122723664-122723686 TGGGACTCTTTCTTGGAACTGGG - Intronic
1092381511 12:8000605-8000627 TGTGCCTCTTTCTTGGTCATAGG - Intergenic
1094587584 12:31792222-31792244 TGCGGCTCTTCCTCGGGCAGCGG - Exonic
1096789435 12:54035733-54035755 TGAAGATCTTTCCTGGGCCTAGG + Intronic
1096841082 12:54379446-54379468 TGGGGCTCCTTCTTGGGTCCAGG + Intronic
1107015398 13:35704841-35704863 CTCAGCTCTTGCTTGGGCCTGGG + Intergenic
1108748195 13:53417379-53417401 TGCCGATCTTTCTTAGGCCATGG + Intergenic
1109388567 13:61665344-61665366 CACGGCTCTTTCTTGTGCCTGGG - Intergenic
1113553501 13:111212327-111212349 TTCGGCTCTGTGATGGGCCTCGG + Intronic
1114268612 14:21088002-21088024 TGGGGCTGTTTCTTGGTCCTGGG - Exonic
1115257557 14:31419571-31419593 TGCAGCACTTTTTTGGGGCTAGG - Intronic
1116068044 14:40008828-40008850 TGTGGCTCTTTCTTGGTTATAGG - Intergenic
1118883523 14:69848637-69848659 TGAGGATCTCTCTGGGGCCTGGG + Intergenic
1119152539 14:72375495-72375517 TGGGGCTCTTTCTCAGGCCCAGG - Intronic
1122357983 14:101135751-101135773 TGTGGCTCTTTCTGGGGCTGGGG + Intergenic
1124508667 15:30303709-30303731 TGCGGATCCTTCTAGGTCCTTGG + Intergenic
1124734890 15:32234952-32234974 TGCGGATCCTTCTAGGTCCTTGG - Intergenic
1124961344 15:34398239-34398261 AGCTCCTCTTGCTTGGGCCTTGG + Intronic
1124977972 15:34544463-34544485 AGCTCCTCTTGCTTGGGCCTTGG + Intronic
1128142706 15:65313422-65313444 TGCAGCTCTTCCTTGAGCCACGG - Intergenic
1128769894 15:70274079-70274101 CGGGGCTCTTTCTTCGACCTGGG + Intergenic
1129559491 15:76551912-76551934 TGCTCCTCTTTCTTTGGCCTGGG + Intronic
1132085019 15:98901345-98901367 AGAGGCTCTTTCTTGAGCTTGGG + Intronic
1135651330 16:24209206-24209228 TGCGTGTTTTTCTTTGGCCTGGG - Intronic
1136407802 16:30058875-30058897 TGAGGCACTGTCTAGGGCCTTGG + Intronic
1137938626 16:52658943-52658965 TGAGGCTGTTTCTCAGGCCTGGG - Intergenic
1139557956 16:67724591-67724613 TGCTGCTTTTTCTTGGTCCTTGG - Exonic
1139558825 16:67729074-67729096 AGCTGCACTTTCTTTGGCCTTGG - Intronic
1141194284 16:81848337-81848359 TGCAGCTCTTTCCTGGGGCAGGG + Intronic
1142137493 16:88458366-88458388 TCCGGGCCTTCCTTGGGCCTGGG + Intronic
1142146754 16:88496006-88496028 TGCGGCTCTCACCTGAGCCTGGG + Intronic
1143350035 17:6281228-6281250 TGTGGCTCATTCTTGGATCTTGG + Intergenic
1143437902 17:6942837-6942859 TGGGGCTGTGTCGTGGGCCTTGG + Intronic
1146762462 17:35490278-35490300 TGCAGCTCTTCCTTTGCCCTTGG - Intronic
1149362638 17:55911135-55911157 TCCAGGTCTTTGTTGGGCCTGGG + Intergenic
1149966627 17:61170911-61170933 AGTGGCTCTTTCCTGGGCCTTGG - Intronic
1150814118 17:68379052-68379074 TGCGTCTCTTTCTGGGCCTTTGG + Intronic
1151707780 17:75779702-75779724 TGCGGCTCTTCCTCGGGCAGCGG - Exonic
1151952929 17:77365131-77365153 GGCGGCTCTTTCTGGGGGCCTGG - Intronic
1152828202 17:82480625-82480647 TGCAGCACTTTCTTGGGGCTGGG - Intronic
1153131329 18:1858061-1858083 TGCGCCTCTTTCTTGGTTGTAGG + Intergenic
1153836589 18:8969481-8969503 TCCTGCCCTTCCTTGGGCCTTGG - Intergenic
1156606321 18:38671415-38671437 TGTGCCTCTTTCTTGGTCGTAGG - Intergenic
1158106441 18:53890090-53890112 TAAGGCTCTTCCCTGGGCCTGGG + Intergenic
1158293543 18:55968973-55968995 TGTGGCTCTTACATGGGCCATGG + Intergenic
1158551536 18:58440178-58440200 TGTGGCTCAATCTTTGGCCTAGG + Intergenic
1165849685 19:38842566-38842588 TGCGGCTGTTTCTGGGGACGTGG + Intronic
1166124066 19:40703297-40703319 TGCTGCTGTATCTTGGCCCTGGG + Intronic
1166127031 19:40721169-40721191 TCTGTCTCTTTCATGGGCCTGGG - Intronic
1166524370 19:43501907-43501929 TGGGCCTCTTCCTTGGACCTAGG - Intronic
1166966431 19:46531920-46531942 TGGGGCTCATCCTAGGGCCTGGG + Intronic
1167108964 19:47447684-47447706 GGCGGGTCTTGGTTGGGCCTCGG - Intronic
1168348890 19:55664531-55664553 TGCGGCTGTGTCTCAGGCCTGGG + Intronic
927178178 2:20424794-20424816 TGGGGCTCTCTCTCTGGCCTGGG + Intergenic
927524114 2:23721528-23721550 TGGGGCTGTTTCTTAGGCCTGGG - Intergenic
928087809 2:28356686-28356708 GGCGGCTCTGTCCTTGGCCTGGG - Intergenic
931953971 2:67397479-67397501 TGCGGCGTTTTCTTCGGGCTAGG - Exonic
932789093 2:74637796-74637818 GGTGGCTCCTTCTTTGGCCTTGG + Intronic
932862102 2:75305000-75305022 TCTTGCTCTTGCTTGGGCCTGGG + Intergenic
935564364 2:104590604-104590626 TGTGCCTCTTTCTTGGTCGTAGG + Intergenic
936639469 2:114296027-114296049 TGAGACTCTTTCTTGGGTCATGG - Intergenic
939585566 2:144000105-144000127 TGAGGCTCTTTCTTTGGCCATGG + Intronic
941528177 2:166631861-166631883 TGCGGATCCATCTGGGGCCTAGG - Intergenic
946255153 2:218436672-218436694 AGCCACTCTTTCTTGGCCCTGGG - Intronic
946304957 2:218851190-218851212 GGTGGCTCTGTCTGGGGCCTTGG + Intergenic
947337083 2:229098567-229098589 AGCTGCTCTTTCCTGGGGCTGGG + Intronic
948470058 2:238171794-238171816 AGCTGCCCCTTCTTGGGCCTCGG - Intronic
948487770 2:238291624-238291646 GGAGCCCCTTTCTTGGGCCTAGG + Intergenic
948624787 2:239262140-239262162 CGTGGCTCCTTCTTGGGCCTTGG - Intronic
1168895251 20:1319642-1319664 TGAGGCTCTGACCTGGGCCTGGG + Exonic
1171042351 20:21777068-21777090 TGCAGCTCCTTCGTGGACCTGGG + Intergenic
1172865125 20:38089986-38090008 TGAGGTTCTTTCTTGAGGCTGGG - Exonic
1173482857 20:43416783-43416805 TGGGGCTGTTTCTCAGGCCTGGG - Intergenic
1173482894 20:43416937-43416959 TGGGGCTGTTTCTCAGGCCTGGG - Intergenic
1174132938 20:48358877-48358899 TGCAGCGCTCTCTTGGGCCCTGG - Intergenic
1175231585 20:57476858-57476880 TGAGGCACTTGCTTGGGCCTTGG - Intergenic
1175570800 20:60020216-60020238 TGGGGCTATTTCTCAGGCCTGGG + Intronic
1179375780 21:40848794-40848816 TGCTGCTCTTCCTTGGGCGTGGG + Intergenic
1180788458 22:18559911-18559933 TGCTGCTGTTTCTTGGGTCATGG - Intergenic
1181233279 22:21435407-21435429 TGCTGCTGTTTCTTGGGTCATGG + Intronic
1181245371 22:21499436-21499458 TGCTGCTGTTTCTTGGGTCATGG - Intergenic
1181420604 22:22795482-22795504 TGCGCCTCTTTCTTGGTTGTAGG - Intronic
1182747076 22:32614382-32614404 TCCAGCTCCTTCCTGGGCCTGGG + Intronic
1184058435 22:42067470-42067492 AGCGGCTGTTTCTTGCCCCTAGG + Intronic
1184805711 22:46793751-46793773 GGCGGCTCTGCCTCGGGCCTGGG - Exonic
1184900491 22:47443824-47443846 CTGGGCTCTGTCTTGGGCCTTGG - Intergenic
1185145984 22:49136946-49136968 TGCAGCTCCCTCTTGGACCTGGG - Intergenic
1185227301 22:49660393-49660415 TGCTCCTCTCTCCTGGGCCTGGG + Intergenic
949170091 3:986947-986969 TGTGCCTCTTTCTTGGTCATGGG + Intergenic
951625934 3:24663187-24663209 TGAGGCTGTTTCTTGGGCCTGGG + Intergenic
951625955 3:24663267-24663289 TGGGGCTCTTTCTCAGGTCTGGG + Intergenic
953925021 3:46978460-46978482 TCAGGCTCTTTGTTGGGGCTGGG - Intronic
954241593 3:49298117-49298139 TGCTGCTCCCCCTTGGGCCTTGG - Intronic
954481609 3:50805504-50805526 TGGGGCTGTTTCTTAGGCCCAGG + Intronic
955309739 3:57873722-57873744 TCCTGCTCTTTCATGGGCCTAGG + Intronic
959952281 3:112193506-112193528 TGGGGCTCTTTCTTGGTCACAGG + Intronic
960683928 3:120278280-120278302 TGCAGTTCTTTCTGGGGACTTGG - Intronic
962648797 3:137467087-137467109 TCCGGCTGTTTCTTTGGGCTGGG + Intergenic
962749163 3:138420595-138420617 TGGGGCTGTATCATGGGCCTTGG - Intergenic
964242846 3:154616515-154616537 TGGGGCTCTTTCTTGAACTTGGG - Intergenic
966044380 3:175531271-175531293 TGTGCCTCTTTCTTGGTCATAGG + Intronic
967040439 3:185687242-185687264 TGTGACGCTTTCTTGGGGCTAGG - Intronic
968921261 4:3523277-3523299 ACAGGCTCTTTCTTGGCCCTTGG + Intronic
968923017 4:3532335-3532357 TGCTGCTCTTCCTCGGGCCCTGG - Exonic
969407284 4:7001955-7001977 TCCTGCTCTTTCTTGGGCCTAGG + Intronic
969408013 4:7007812-7007834 TGCTCCTGTTTCTTGGCCCTTGG + Intronic
972424491 4:38919576-38919598 TGGGACCATTTCTTGGGCCTGGG + Intronic
975315061 4:72942480-72942502 TGCTGCTCCTGCTTGGGACTGGG + Intergenic
976104957 4:81606665-81606687 ACGGGCTCTTTCTGGGGCCTAGG + Intronic
976132008 4:81894666-81894688 TGCTTCTCTTTCTTGTGTCTGGG - Intronic
979195329 4:117914492-117914514 TGCGGCACTTTTATGGGACTGGG - Intergenic
980705341 4:136485723-136485745 TCAGCCTCTTTCTTTGGCCTTGG - Intergenic
981688376 4:147480534-147480556 TGAGGCTCCTTCTTTGCCCTGGG + Intergenic
983542893 4:168931496-168931518 TGGGGCTCTTTCTTAGGCCCTGG - Intronic
984101634 4:175494581-175494603 AGCTGCTCTTTCTTGGCCCCAGG - Intergenic
985050712 4:185988310-185988332 TGGGTCTCTTTCTCGGGACTCGG - Intergenic
986558868 5:9040322-9040344 AGCCGCTCTTCCTTAGGCCTGGG - Exonic
991318389 5:65338753-65338775 CACGGCTGTTTCTTAGGCCTGGG - Intronic
991938507 5:71827582-71827604 TGGGGCTGTTTCTGTGGCCTGGG + Intergenic
992207566 5:74445790-74445812 TGCAGTTTTTTTTTGGGCCTAGG - Intergenic
992945378 5:81803975-81803997 TGGGGCTGTTTCTAAGGCCTGGG - Intergenic
993376467 5:87154521-87154543 TGTGTCTCATTCTGGGGCCTAGG - Intergenic
993791738 5:92218566-92218588 TGTGGCTCTTTCTTGGTTGTAGG - Intergenic
998513575 5:142733664-142733686 GGGGGCACTTTCTTGGGCCATGG - Intergenic
999999162 5:157120814-157120836 TGGGGCTGTTTCTCAGGCCTAGG - Intronic
1000479762 5:161757622-161757644 TGCAGGTCTTTCTTGTGCCTAGG + Intergenic
1000708772 5:164544876-164544898 TGGGGCTCTTTCTTTGTCCCAGG - Intergenic
1000999674 5:167994029-167994051 TGGGGCTCTTTGTTGGGGCCAGG - Intronic
1003358848 6:5404084-5404106 TGAGGCTCTGCCTTGAGCCTTGG + Intronic
1004933029 6:20479910-20479932 TGCAGCTCTTCCTTTGCCCTTGG - Exonic
1006979660 6:38136762-38136784 TGCTGTTCTTTCTTGGACCATGG + Intronic
1012757816 6:103254033-103254055 ATCGGCTGATTCTTGGGCCTTGG + Intergenic
1013154215 6:107477654-107477676 TGGGGTACTTTCTTGAGCCTAGG - Intergenic
1013779772 6:113716546-113716568 TGCAGCTCTTTCTTGATCCTTGG + Intergenic
1018895366 6:168012978-168013000 TGCGGCTGTTTCTTGGGCCTGGG + Intronic
1019660765 7:2222843-2222865 CTCGGCTCTTTTTTGTGCCTCGG - Intronic
1020211241 7:6159569-6159591 TGCGGCTCTGCCTGGGGGCTGGG + Intronic
1022771550 7:33478295-33478317 TGGGGCCCATTCTTGGGCCCAGG + Intronic
1024744149 7:52388089-52388111 TGTGGCTCTTTCTTGGTTGTAGG - Intergenic
1025678810 7:63665361-63665383 TGGGGCTCTTTCAGGGGCTTTGG + Intergenic
1028385358 7:90246958-90246980 TACTGCTCTTTCCAGGGCCTAGG + Intronic
1029724916 7:102396445-102396467 TGCGGCTCTTTCTTGGGCCTCGG - Exonic
1030457515 7:109793401-109793423 TGTGCCTCTTTCTTGGGTGTAGG + Intergenic
1032950681 7:136907602-136907624 TGTGCCTCTCTCTTGAGCCTAGG + Intronic
1034503007 7:151463549-151463571 TGGGGCTCTTTCCTTTGCCTGGG - Intergenic
1035352232 7:158254956-158254978 TGCAGCTTCTTCCTGGGCCTGGG - Intronic
1039150444 8:34499005-34499027 TGTGTCTCTTTCTGTGGCCTTGG + Intergenic
1039324226 8:36466875-36466897 TGCGGCTCTTTCTTGGTTGTAGG + Intergenic
1041177498 8:55211841-55211863 TGGGGCTCTGTCATGGGCCATGG - Intronic
1041934503 8:63320980-63321002 TGTGCCTCTTTCTTGGTCATAGG - Intergenic
1045485525 8:102628131-102628153 TGGGGCTCTTGCTTGGGGCTGGG + Intergenic
1046611973 8:116435823-116435845 AGTGGTTCTTTCTTTGGCCTTGG - Intergenic
1046883525 8:119337234-119337256 TGTGGCTCTTTGCTGAGCCTGGG + Intergenic
1047222809 8:122932127-122932149 AGCTGCTCTTTCTTGGGAATGGG - Intronic
1048083895 8:131157192-131157214 TGTGCCTCTTTCTTGGGTGTAGG + Intergenic
1053053376 9:34979134-34979156 TGCAGATCTTTCTTGGGCTGTGG - Exonic
1057877886 9:98771634-98771656 TGCTGATCTTTTTTGTGCCTTGG + Intronic
1058744115 9:107973242-107973264 TGAGGCACTTTACTGGGCCTGGG - Intergenic
1060666320 9:125434150-125434172 TGGGCCTCTGTCTTGGCCCTTGG - Intergenic
1061031256 9:128084712-128084734 TGGGGCTGTATCATGGGCCTTGG + Intronic
1062169373 9:135126494-135126516 TGCGGCTCATCAGTGGGCCTGGG - Intergenic
1062414162 9:136439526-136439548 TGCGGCTCCCGCTTGGGCCGGGG + Exonic
1203654162 Un_KI270752v1:7519-7541 TGGGTCTCTGTCTTGAGCCTGGG + Intergenic
1185488615 X:501452-501474 TGCAGCTCTATCCTGGGACTAGG - Intergenic
1186384150 X:9092111-9092133 TGTGCCTCTTTCTTGGGTATAGG + Intronic
1186450266 X:9666739-9666761 TGCAGCTCTGTCTTTGTCCTGGG + Intronic
1187477922 X:19628286-19628308 GGCTGCTCTTTCTTGGGCCCTGG - Intronic
1190540926 X:51477968-51477990 TGCAGCTCTGTCTTTGTCCTTGG - Intergenic
1197591818 X:128419041-128419063 TGTGCCTCTTTCTTGGTCGTAGG - Intergenic
1199024326 X:142919368-142919390 TGTGCCTCTTTCTTGGTCGTAGG - Intergenic