ID: 1029724921

View in Genome Browser
Species Human (GRCh38)
Location 7:102396474-102396496
Sequence CGTCATCCCCAAGAATGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724914_1029724921 20 Left 1029724914 7:102396431-102396453 CCTCGGTGCGACCACCGAGGCCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724915_1029724921 9 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724918_1029724921 -1 Left 1029724918 7:102396452-102396474 CCAAGAAAGAGCCGCAGACGCTC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724912_1029724921 23 Left 1029724912 7:102396428-102396450 CCTCCTCGGTGCGACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724916_1029724921 6 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724917_1029724921 0 Left 1029724917 7:102396451-102396473 CCCAAGAAAGAGCCGCAGACGCT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724911_1029724921 26 Left 1029724911 7:102396425-102396447 CCGCCTCCTCGGTGCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724910_1029724921 30 Left 1029724910 7:102396421-102396443 CCAGCCGCCTCCTCGGTGCGACC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724921 Original CRISPR CGTCATCCCCAAGAATGCGG CGG Exonic