ID: 1029724921

View in Genome Browser
Species Human (GRCh38)
Location 7:102396474-102396496
Sequence CGTCATCCCCAAGAATGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724910_1029724921 30 Left 1029724910 7:102396421-102396443 CCAGCCGCCTCCTCGGTGCGACC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724912_1029724921 23 Left 1029724912 7:102396428-102396450 CCTCCTCGGTGCGACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724915_1029724921 9 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724914_1029724921 20 Left 1029724914 7:102396431-102396453 CCTCGGTGCGACCACCGAGGCCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724911_1029724921 26 Left 1029724911 7:102396425-102396447 CCGCCTCCTCGGTGCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724918_1029724921 -1 Left 1029724918 7:102396452-102396474 CCAAGAAAGAGCCGCAGACGCTC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724916_1029724921 6 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47
1029724917_1029724921 0 Left 1029724917 7:102396451-102396473 CCCAAGAAAGAGCCGCAGACGCT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724921 Original CRISPR CGTCATCCCCAAGAATGCGG CGG Exonic
905971289 1:42144461-42144483 CATCAATCCCATGAATGCGGTGG + Intergenic
906529194 1:46513457-46513479 CCTCATTCCCAAGATTGAGGAGG + Exonic
910289925 1:85589611-85589633 CCCCAACCCCAAGAATGCTGTGG - Intergenic
1071255458 10:83868153-83868175 AGTGATCCCCCAGAATGCTGAGG - Intergenic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1076827579 10:132977036-132977058 GGTCATCCCCAAGACTTCAGGGG - Intergenic
1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG + Intronic
1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG + Intronic
1088256041 11:107904388-107904410 AGTCATCCACAGGAATGCAGTGG + Intronic
1089612367 11:119676662-119676684 CCTCCTCCCCAAGAATCTGGGGG + Intronic
1102182682 12:110924074-110924096 CATCAGCCTCAAGACTGCGGGGG + Intergenic
1105841425 13:24256868-24256890 CACCATCCCCAACAATGCAGTGG - Intronic
1123983843 15:25626752-25626774 TGTCATCCCCAGGAATCAGGGGG - Intergenic
1124209873 15:27753846-27753868 CGTCATCCCCTACAATGCTCAGG - Intergenic
1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG + Exonic
1136512712 16:30748804-30748826 CGTCATCCTGAAGGAGGCGGGGG - Exonic
1137852044 16:51755435-51755457 CGTCAGCCCGAGGAATGCGCAGG - Intergenic
1144429428 17:15177501-15177523 CTTGATCCCCAAGAAAGGGGTGG - Intergenic
1154409212 18:14127423-14127445 TGTAACCCCCAAGAATGCAGAGG - Intronic
1161474344 19:4475772-4475794 TGTCATCACCATGAATGGGGTGG - Intronic
1161480954 19:4510452-4510474 CTTCCACCCCATGAATGCGGAGG - Exonic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1164210445 19:23093531-23093553 CCCCACCCCCAAGAATGAGGGGG - Intronic
1166037223 19:40177582-40177604 CCACATCCCCAAGAATTTGGAGG - Intergenic
926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG + Intronic
929866178 2:45719235-45719257 CATCATCTCCAAGAAGCCGGAGG - Intronic
932816991 2:74870046-74870068 CGTGACACCCAAGAGTGCGGTGG + Intronic
934125205 2:88881777-88881799 CACCATCCCCAAAAATGCAGTGG - Intergenic
942698523 2:178675936-178675958 GGTCATTCCCAAGAAAGAGGAGG - Exonic
1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG + Intergenic
1180784528 22:18539432-18539454 AGTGATCCCCAAGATTGCTGGGG - Intergenic
1181080616 22:20412394-20412416 GGTCATGCCCAAGTATGCCGTGG - Intergenic
1181128105 22:20713485-20713507 AGTGATCCCCAAGATTGCTGGGG - Intronic
1181241431 22:21478789-21478811 AGTGATCCCCAAGATTGCTGGGG - Intergenic
1183299266 22:37050918-37050940 CGTCCTCCCTAAGAAGGAGGAGG - Intergenic
950210599 3:11120310-11120332 CCTCATAGCCAAGAATGTGGTGG + Intergenic
954714611 3:52520855-52520877 CGTAATCCCAAAGAGTGCAGCGG - Exonic
955331205 3:58049245-58049267 GGCCATCCCCGAGAAGGCGGTGG - Intronic
959717858 3:109453090-109453112 CACCATCCCCAAAAATGCAGTGG - Intergenic
968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG + Intergenic
968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG + Intergenic
969526885 4:7708393-7708415 CGTTATTCCCAAGAAGGCGAGGG + Intronic
1004807296 6:19217654-19217676 CGTCCTCCCCAAAACTGCAGTGG + Intergenic
1006937814 6:37730555-37730577 CGTCCTCCCCACAAATGCGGAGG - Intergenic
1011131025 6:84051915-84051937 CGTCTTCCCCAACAATGGGCTGG + Intronic
1013159254 6:107525527-107525549 CACCTTCCCCAAGAATGCTGTGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1032265284 7:130366164-130366186 GGTCCTCCCCAAGAATGCACAGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1048493996 8:134920343-134920365 CGTGAGCCCCAAGAAAGCTGTGG - Intergenic
1060061690 9:120466363-120466385 CATCATCCCCCAGAATGGGATGG - Intronic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1193902551 X:87200139-87200161 CCTCATCCCCCAGAAGGAGGTGG - Intergenic
1196277654 X:113786627-113786649 CTAGATCCCCAAAAATGCGGAGG - Intergenic