ID: 1029724922

View in Genome Browser
Species Human (GRCh38)
Location 7:102396477-102396499
Sequence CATCCCCAAGAATGCGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029724916_1029724922 9 Left 1029724916 7:102396445-102396467 CCGAGGCCCAAGAAAGAGCCGCA 0: 1
1: 1
2: 2
3: 20
4: 189
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724919_1029724922 -9 Left 1029724919 7:102396463-102396485 CCGCAGACGCTCGTCATCCCCAA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724911_1029724922 29 Left 1029724911 7:102396425-102396447 CCGCCTCCTCGGTGCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724917_1029724922 3 Left 1029724917 7:102396451-102396473 CCCAAGAAAGAGCCGCAGACGCT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724914_1029724922 23 Left 1029724914 7:102396431-102396453 CCTCGGTGCGACCACCGAGGCCC 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724912_1029724922 26 Left 1029724912 7:102396428-102396450 CCTCCTCGGTGCGACCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724915_1029724922 12 Left 1029724915 7:102396442-102396464 CCACCGAGGCCCAAGAAAGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1029724918_1029724922 2 Left 1029724918 7:102396452-102396474 CCAAGAAAGAGCCGCAGACGCTC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029724922 Original CRISPR CATCCCCAAGAATGCGGCGG AGG Exonic
901882899 1:12204388-12204410 CAGCCCCAAGCATGTGGTGGGGG - Intronic
905971292 1:42144464-42144486 CAATCCCATGAATGCGGTGGGGG + Intergenic
915433023 1:155881370-155881392 CACCACCAAGAATGAGGTGGTGG + Exonic
1068377921 10:56209200-56209222 CTTCCCCAAAAATGAGGAGGCGG - Intergenic
1068825262 10:61430720-61430742 CATCCCCAAAAATGCCACGTAGG + Intronic
1069114779 10:64491154-64491176 CATCCCCTAGAATGGGTCAGGGG - Intergenic
1074815650 10:117139641-117139663 CAATTCCAAGAATGGGGCGGAGG + Intergenic
1077016152 11:399903-399925 CATCCCCAGAAACGCGGAGGGGG + Intronic
1096686112 12:53289316-53289338 CATCCCCAAGACTCCTGCTGGGG + Intronic
1096749262 12:53748312-53748334 CATCCCCAACACTGCGGGGCAGG + Intergenic
1102201574 12:111061053-111061075 CAGCCCCAAGGAAGCGGGGGAGG - Intronic
1103595256 12:122021536-122021558 CAGCCCCCAGAGCGCGGCGGCGG - Exonic
1104384980 12:128342778-128342800 CATCCCCAAGCATCCAGCAGGGG - Intronic
1104461197 12:128957580-128957602 CATCCCCGGGAATGCTGCCGTGG + Exonic
1104730346 12:131102314-131102336 CATTGCCGAGAATGCTGCGGTGG + Intronic
1105031449 12:132887276-132887298 CGTCCCCAGGGCTGCGGCGGCGG + Exonic
1113843499 13:113373325-113373347 CATCTCCAAGAATTCTGGGGAGG - Intergenic
1113932850 13:113977287-113977309 CATCTCCAGGAATGCAGAGGGGG - Intergenic
1121252053 14:92506541-92506563 CATCCCCAAGAAGACGGCCCTGG - Intergenic
1122044383 14:99012770-99012792 CAGCCCCAAGGATCCGGTGGCGG + Intergenic
1124552841 15:30697253-30697275 CATCCCAAATAATGCTGAGGAGG + Intronic
1124678401 15:31708417-31708439 CATCCCAAATAATGCTGAGGAGG - Intronic
1130115548 15:81001888-81001910 CATGCCCAAGAAGGCGGCGGCGG + Exonic
1132888742 16:2194198-2194220 CAGGCCCAAGAATGCCGTGGAGG - Intronic
1138915251 16:61455661-61455683 AATCCCCAAGAATGCTCCAGTGG - Intergenic
1152719803 17:81917937-81917959 CATCCTGAGGAAGGCGGCGGCGG - Exonic
1154300921 18:13191938-13191960 CACCCCCTAGAATGTGGCAGGGG + Intergenic
1158574521 18:58624948-58624970 CATCATCAAGAAGGCGGGGGAGG + Intronic
1161474341 19:4475769-4475791 CATCACCATGAATGGGGTGGGGG - Intronic
1162931138 19:13958404-13958426 CATCCCCCAGAATGCAGCTCAGG - Intronic
930121682 2:47765910-47765932 CATTACCCAGAGTGCGGCGGAGG + Intronic
934125203 2:88881774-88881796 CATCCCCAAAAATGCAGTGGAGG - Intergenic
934843406 2:97645942-97645964 CACTCCCAAGACTGTGGCGGGGG - Intergenic
937296204 2:120811320-120811342 CAACCCAAAGAATGAGGCTGGGG - Intronic
937845379 2:126573481-126573503 CCTCCCCAAGGATGCGGGTGCGG + Intergenic
943058284 2:183010394-183010416 CATCCCCCAGAATGCACCAGTGG + Intronic
946182931 2:217959856-217959878 CCTCTCCAGGAATGCGGCTGGGG + Intronic
949063828 2:241977129-241977151 CATCCCAAAGAGTGGAGCGGTGG - Intergenic
1174041422 20:47702657-47702679 CTTCCCGAAGAAAGCTGCGGAGG + Exonic
1181080613 22:20412391-20412413 CATGCCCAAGTATGCCGTGGGGG - Intergenic
1181085130 22:20436397-20436419 CGGCCCCAGGAATGCAGCGGCGG - Intronic
1183479774 22:38057167-38057189 CCTTCCCAAGATGGCGGCGGCGG + Intronic
1184670419 22:46009497-46009519 CATAACCAAGAATGCAGCGGTGG + Intergenic
952143334 3:30503558-30503580 CATTCCCCAGAATCCGGAGGAGG - Intergenic
953335521 3:42090992-42091014 TATCCCCAAGAATGCATCTGTGG + Intronic
954714610 3:52520852-52520874 AATCCCAAAGAGTGCAGCGGAGG - Exonic
956063796 3:65375745-65375767 CATCCCCAGGAATGATGCGGAGG + Exonic
959717856 3:109453087-109453109 CATCCCCAAAAATGCAGTGGAGG - Intergenic
959726712 3:109551488-109551510 CTTCCCTAAGAATGTGGAGGAGG + Intergenic
963835150 3:150050716-150050738 CCTCCTCAAGATGGCGGCGGCGG + Intronic
968968877 4:3783298-3783320 CATCACCAAGACTGCAGGGGAGG + Intergenic
981836330 4:149058500-149058522 CATCCCCCAAAATGCTGCAGAGG + Intergenic
984720626 4:182969806-182969828 CATCCCCTAGAAGGCGGGTGTGG - Intergenic
998177537 5:139911137-139911159 CAGCCCCAACAATGGGGTGGGGG + Intronic
1006825257 6:36930102-36930124 CCTCCCCAAAAACGGGGCGGGGG + Intergenic
1016795398 6:148112157-148112179 CATCAACAAGAATGGGGCAGGGG - Intergenic
1019891046 7:3946745-3946767 GTTACCCAAGAATGCAGCGGAGG + Intronic
1021682573 7:23149279-23149301 CCTCCCCAAGAATAGGGCTGGGG - Intronic
1029724922 7:102396477-102396499 CATCCCCAAGAATGCGGCGGAGG + Exonic
1029993466 7:104983970-104983992 CCTCCTGAAGAATGCGGAGGAGG + Intergenic
1032265282 7:130366161-130366183 CCTCCCCAAGAATGCACAGGAGG - Intronic
1035028792 7:155844213-155844235 CATCCACAGGCAGGCGGCGGGGG - Intergenic
1044734889 8:95269083-95269105 CAGCCCAAAGGCTGCGGCGGCGG - Exonic
1045993869 8:108340549-108340571 CATTCCCAAGAATGCTGGGTGGG - Intronic
1051419098 9:16872004-16872026 CGGCCGCAAGAATGGGGCGGGGG + Intergenic
1062427802 9:136514002-136514024 CATACCCAAGACTGCGGCAGGGG + Intronic
1186818817 X:13265315-13265337 TATCCACAAGAATGTGGAGGAGG - Intergenic
1191588167 X:62851420-62851442 CATCCCCAAAAAGGAGGTGGTGG - Intergenic
1196046355 X:111260248-111260270 CCTGCCCAAGAATGGGGCGGCGG + Intronic